Gene Page:EPB41L1
Summary?
| GeneID | 2036 |
| Symbol | EPB41L1 |
| Synonyms | 4.1N|MRD11 |
| Description | erythrocyte membrane protein band 4.1-like 1 |
| Reference | MIM:602879|HGNC:HGNC:3378|Ensembl:ENSG00000088367|HPRD:04193|Vega:OTTHUMG00000032378 |
| Gene type | protein-coding |
| Map location | 20q11.2-q12 |
| Pascal p-value | 0.914 |
| Sherlock p-value | 0.842 |
| Fetal beta | -0.638 |
| eGene | 元 |
| Support | STRUCTURAL PLASTICITY G2Cdb.human_BAYES-COLLINS-HUMAN-PSD-CONSENSUS G2Cdb.human_BAYES-COLLINS-HUMAN-PSD-FULL G2Cdb.human_BAYES-COLLINS-MOUSE-PSD-CONSENSUS CompositeSet Darnell FMRP targets Potential synaptic genes |
Gene in Data Sources
| Gene set name | Method of gene set | Description | Info |
|---|---|---|---|
| CV:PGCnp | Genome-wide Association Study | GWAS | |
| DNM:Fromer_2014 | Whole Exome Sequencing analysis | This study reported a WES study of 623 schizophrenia trios, reporting DNMs using genomic DNA. | |
| Network | Shortest path distance of core genes in the Human protein-protein interaction network | Contribution to shortest path in PPI network: 0.5394 |
Section I. Genetics and epigenetics annotation
DNM table
DNM table| Gene | Chromosome | Position | Ref | Alt | Transcript | AA change | Mutation type | Sift | CG46 | Trait | Study |
|---|---|---|---|---|---|---|---|---|---|---|---|
| EPB41L1 | chr20 | 34797641 | G | A | NM_001258329 NM_001258330 NM_001258331 NM_012156 NM_177996 |
p.634E>K . p.560E>K p.634E>K p.560E>K |
missense intronic missense missense missense |
Schizophrenia | DNM:Fromer_2014 |
Section II. Transcriptome annotation
General gene expression (GTEx)
Gene expression during devlopment (BrainCloud)
Footnote:
A total of 269 time points ploted, with n=38 fetal samples (x=1:38). Each triangle represents one time point.
Gene expression of temporal and spatial changes (BrainSpan)
Footnote:
SC: sub-cortical regions; SM: sensory-motor regions; FC: frontal cortex; and TP: temporal-parietal cortex
ST1: fetal (13 - 26 postconception weeks), ST2: early infancy to late childhood (4 months to 11 years), and ST3: adolescence to adulthood (13 - 23 years)
The bar shown representes the lower 25% and upper 25% of the expression distribution.
Top co-expressed genes in brain regions
| Top 10 positively co-expressed genes | ||
| Gene | Pearson's Correlation | Spearman's Correlation |
| TRPV6 | 0.84 | 0.89 |
| KCNJ11 | 0.80 | 0.81 |
| KCNQ4 | 0.80 | 0.81 |
| DUSP7 | 0.79 | 0.84 |
| GFRA2 | 0.78 | 0.80 |
| CACNB1 | 0.78 | 0.80 |
| KLC2 | 0.78 | 0.78 |
| BAIAP2 | 0.77 | 0.81 |
| POU6F1 | 0.76 | 0.78 |
| AC021534.1 | 0.75 | 0.81 |
| Top 10 negatively co-expressed genes | ||
| Gene | Pearson's Correlation | Spearman's Correlation |
| RAB13 | -0.51 | -0.61 |
| AF347015.21 | -0.50 | -0.42 |
| NSBP1 | -0.49 | -0.55 |
| DBI | -0.48 | -0.53 |
| AP002478.3 | -0.47 | -0.49 |
| GNG11 | -0.45 | -0.47 |
| AL139819.3 | -0.45 | -0.45 |
| MYL12A | -0.44 | -0.50 |
| AF347015.18 | -0.44 | -0.39 |
| AF347015.31 | -0.43 | -0.37 |
Section III. Gene Ontology annotation
| Molecular function | 去term | Evidence | Neuro keywords | PubMed ID |
|---|---|---|---|---|
| 去:0003779 | actin binding | IEA | - | |
| 去:0005488 | binding | IEA | - | |
| 去:0005198 | structural molecule activity | IEA | - | |
| 去:0008092 | cytoskeletal protein binding | IEA | - | |
| Biological process | 去term | Evidence | Neuro keywords | PubMed ID |
| 去:0030866 | cortical actin cytoskeleton organization | IEA | - | |
| Cellular component | 去term | Evidence | Neuro keywords | PubMed ID |
| 去:0005856 | cytoskeleton | IEA | - | |
| 去:0005737 | cytoplasm | IEA | - | |
| 去:0019898 | extrinsic to membrane | IEA | - |
Section V. Pathway annotation
| Pathway name | Pathway size | # SZGR 2.0 genes in pathway | Info |
|---|---|---|---|
| KEGG TIGHT JUNCTION | 134 | 86 | All SZGR 2.0 genes in this pathway |
| PID PI3K PLC TRK PATHWAY | 36 | 31 | All SZGR 2.0 genes in this pathway |
| REACTOME TRANSMISSION ACROSS CHEMICAL SYNAPSES | 186 | 155 | All SZGR 2.0 genes in this pathway |
| REACTOME NEURONAL SYSTEM | 279 | 221 | All SZGR 2.0 genes in this pathway |
| REACTOME NEUROTRANSMITTER RECEPTOR BINDING AND DOWNSTREAM TRANSMISSION IN THE POSTSYNAPTIC CELL | 137 | 110 | All SZGR 2.0 genes in this pathway |
| REACTOME TRAFFICKING OF AMPA RECEPTORS | 28 | 23 | All SZGR 2.0 genes in this pathway |
| SCIBETTA KDM5B TARGETS DN | 81 | 55 | All SZGR 2.0 genes in this pathway |
| DODD NASOPHARYNGEAL CARCINOMA UP | 1821 | 933 | All SZGR 2.0 genes in this pathway |
| 去ZGIT ESR1 TARGETS DN | 781 | 465 | All SZGR 2.0 genes in this pathway |
| LIN SILENCED BY TUMOR MICROENVIRONMENT | 108 | 73 | All SZGR 2.0 genes in this pathway |
| ZHANG RESPONSE TO IKK INHIBITOR AND TNF DN | 103 | 64 | All SZGR 2.0 genes in this pathway |
| NIKOLSKY BREAST CANCER 20Q11 AMPLICON | 31 | 18 | All SZGR 2.0 genes in this pathway |
| ASTIER INTEGRIN SIGNALING | 59 | 44 | All SZGR 2.0 genes in this pathway |
| MOREAUX MULTIPLE MYELOMA BY TACI UP | 412 | 249 | All SZGR 2.0 genes in this pathway |
| KAAB HEART ATRIUM VS VENTRICLE UP | 249 | 170 | All SZGR 2.0 genes in this pathway |
| MONNIER POSTRADIATION TUMOR ESCAPE UP | 393 | 244 | All SZGR 2.0 genes in this pathway |
| LEIN LOCALIZED TO DISTAL AND PROXIMAL DENDRITES | 17 | 12 | All SZGR 2.0 genes in this pathway |
| 郑IL22信号DN | 42 | 26 | All SZGR 2.0 genes in this pathway |
| RAY TUMORIGENESIS BY ERBB2 CDC25A DN | 159 | 105 | All SZGR 2.0 genes in this pathway |
| SHEDDEN肺癌好生存A4 | 196 | 124 | All SZGR 2.0 genes in this pathway |
| HAN SATB1 TARGETS DN | 442 | 275 | All SZGR 2.0 genes in this pathway |
| MEISSNER NPC HCP WITH H3K4ME3 AND H3K27ME3 | 142 | 103 | All SZGR 2.0 genes in this pathway |
| MEISSNER BRAIN HCP WITH H3K4ME3 AND H3K27ME3 | 1069 | 729 | All SZGR 2.0 genes in this pathway |
| KOBAYASHI EGFR SIGNALING 24HR UP | 101 | 65 | All SZGR 2.0 genes in this pathway |
| LEE BMP2 TARGETS DN | 882 | 538 | All SZGR 2.0 genes in this pathway |
| 去BERT OLIGODENDROCYTE DIFFERENTIATION DN | 1080 | 713 | All SZGR 2.0 genes in this pathway |
| WAKABAYASHI ADIPOGENESIS PPARG BOUND 8D | 658 | 397 | All SZGR 2.0 genes in this pathway |
| FORTSCHEGGER PHF8 TARGETS DN | 784 | 464 | All SZGR 2.0 genes in this pathway |
| ZWANG TRANSIENTLY UP BY 1ST EGF PULSE ONLY | 1839 | 928 | All SZGR 2.0 genes in this pathway |
| ZWANG EGF PERSISTENTLY DN | 61 | 36 | All SZGR 2.0 genes in this pathway |
Section VI. microRNA annotation
| miRNA family | Target position | miRNA ID | miRNA seq | ||
|---|---|---|---|---|---|
| UTR start | UTR end | Match method | |||
| miR-101 | 110 | 116 | m8 | hsa-miR-101 | UACAGUACUGUGAUAACUGAAG |
| miR-128 | 1025 | 1031 | 1A | hsa-miR-128a | UCACAGUGAACCGGUCUCUUUU |
| hsa-miR-128b | UCACAGUGAACCGGUCUCUUUC | ||||
| miR-149 | 39 | 45 | 1A | hsa-miR-149brain | UCUGGCUCCGUGUCUUCACUCC |
| miR-18 | 3292 | 3299 | 1A,m8 | hsa-miR-18a | UAAGGUGCAUCUAGUGCAGAUA |
| hsa-miR-18b | UAAGGUGCAUCUAGUGCAGUUA | ||||
| miR-199 | 630 | 636 | m8 | hsa-miR-199a | CCCAGUGUUCAGACUACCUGUUC |
| hsa-miR-199b | CCCAGUGUUUAGACUAUCUGUUC | ||||
| miR-218 | 3224 | 3230 | m8 | hsa-miR-218brain | UUGUGCUUGAUCUAACCAUGU |
| miR-27 | 4 | 10 | 1A | hsa-miR-27abrain | UUCACAGUGGCUAAGUUCCGC |
| hsa-miR-27bbrain | UUCACAGUGGCUAAGUUCUGC | ||||
| hsa-miR-27abrain | UUCACAGUGGCUAAGUUCCGC | ||||
| hsa-miR-27bbrain | UUCACAGUGGCUAAGUUCUGC | ||||
| miR-326 | 41 | 47 | 1A | hsa-miR-326 | CCUCUGGGCCCUUCCUCCAG |
| miR-33 | 485 | 491 | 1A | hsa-miR-33 | GUGCAUUGUAGUUGCAUUG |
| hsa-miR-33b | GUGCAUUGCUGUUGCAUUGCA | ||||
| miR-381 | 3411 | 3418 | 1A,m8 | hsa-miR-381 | UAUACAAGGGCAAGCUCUCUGU |
| miR-431 | 532 | 539 | 1A,m8 | hsa-miR-431 | UGUCUUGCAGGCCGUCAUGCA |
| miR-486 | 181 | 187 | 1A | hsa-miR-486 | UCCUGUACUGAGCUGCCCCGAG |
| miR-494 | 3202 | 3208 | 1A | hsa-miR-494brain | UGAAACAUACACGGGAAACCUCUU |
| miR-500 | 896 | 902 | m8 | hsa-miR-500 | AUGCACCUGGGCAAGGAUUCUG |
| miR-542-3p | 113 | 119 | m8 | hsa-miR-542-3p | UGUGACAGAUUGAUAACUGAAA |
- SZ: miRNAs which differentially expressed in brain cortex of schizophrenia patients comparing with control samples using microarray. Clickhereto see the list of SZ related miRNAs.
- Brain: miRNAs which are expressed in brain based on miRNA microarray expression studies. Clickhereto see the list of brain related miRNAs.