Gene Page:AK2

Summary?
GeneID 204
象征 AK2
Synonyms ADK2
Description adenylate kinase 2
Reference MIM:103020|HGNC:HGNC:362|Ensembl:ENSG00000004455|HPRD:00047|Vega:OTTHUMG00000004131
Gene type protein-coding
Map location 1p34
Pascal p-value 0.767
Sherlock p-value 0.01
Fetal beta 0.94

Gene in Data Sources
Gene set name Method of gene set Description Info
CV:PGCnp Genome-wide Association Study GWAS
Network Shortest path distance of core genes in the Human protein-protein interaction network Contribution to shortest path in PPI network: 0.0044

部分I. Genetics and epigenetics annotation


部分II. Transcriptome annotation

General gene expression (GTEx)

Not available

Gene expression during devlopment (BrainCloud)

Footnote:
A total of 269 time points ploted, with n=38 fetal samples (x=1:38). Each triangle represents one time point.

Gene expression of temporal and spatial changes (BrainSpan)

Footnote:
SC: sub-cortical regions; SM: sensory-motor regions; FC: frontal cortex; and TP: temporal-parietal cortex
死神:胎儿(13 - 26 postconceptionweeks), ST2: early infancy to late childhood (4 months to 11 years), and ST3: adolescence to adulthood (13 - 23 years)
The bar shown representes the lower 25% and upper 25% of the expression distribution.

Top co-expressed genes in brain regions

Top 10 positively co-expressed genes
Gene Pearson's Correlation Spearman's Correlation
RBM15B 0.97 0.96
DBN1 0.96 0.95
NUP62 0.96 0.93
CSNK1E 0.96 0.94
ZNF282 0.95 0.95
PATZ1 0.95 0.92
MARCKSL1 0.95 0.88
CCDC97 0.95 0.94
KDM2B 0.95 0.94
ZC3H10 0.95 0.91
Top 10 negatively co-expressed genes
Gene Pearson's Correlation Spearman's Correlation
C5orf53 -0.75 -0.78
AF347015.31 -0.74 -0.88
AF347015.27 -0.74 -0.88
MT-CO2 -0.73 -0.88
HLA-F -0.73 -0.76
AF347015.33 -0.72 -0.86
S100B -0.72 -0.83
FXYD1 -0.71 -0.84
AIFM3 -0.71 -0.74
MT-CYB -0.70 -0.84

部分III. Gene Ontology annotation

Molecular function 去的术语 Evidence Neuro keywords PubMed ID
GO:0000166 nucleotide binding IEA -
GO:0004017 adenylate kinase activity TAS 9504408
GO:0005524 ATP binding IEA -
GO:0016740 transferase activity IEA -
GO:0019206 nucleoside kinase activity EXP 6182143
Biological process 去的术语 Evidence Neuro keywords PubMed ID
GO:0006139 nucleobase, nucleoside, nucleotide and nucleic acid metabolic process IEA -
Cellular component 去的术语 Evidence Neuro keywords PubMed ID
GO:0005739 mitochondrion IEA -
GO:0005758 mitochondrial intermembrane space EXP 6182143
GO:0005758 mitochondrial intermembrane space IEA -

部分V. Pathway annotation

Pathway name Pathway size # SZGR 2.0 genes in pathway Info
KEGG PURINE METABOLISM 159 96 All SZGR 2.0 genes in this pathway
REACTOME METABOLISM OF NUCLEOTIDES 72 45 All SZGR 2.0 genes in this pathway
REACTOME SYNTHESIS AND INTERCONVERSION OF NUCLEOTIDE DI AND TRIPHOSPHATES 19 10 All SZGR 2.0 genes in this pathway
LIU SOX4 TARGETS DN 309 191 All SZGR 2.0 genes in this pathway
FULCHER INFLAMMATORY RESPONSE LECTIN VS LPS DN 463 290 All SZGR 2.0 genes in this pathway
DIAZ CHRONIC MEYLOGENOUS LEUKEMIA UP 1382 904 All SZGR 2.0 genes in this pathway
RHEIN ALL GLUCOCORTICOID THERAPY DN 362 238 All SZGR 2.0 genes in this pathway
MULLIGHAN NPM1 MUTATED SIGNATURE 1 UP 276 165 All SZGR 2.0 genes in this pathway
MULLIGHAN MLL SIGNATURE 1 UP 380 236 All SZGR 2.0 genes in this pathway
MULLIGHAN MLL SIGNATURE 2 UP 418 263 All SZGR 2.0 genes in this pathway
MULLIGHAN NPM1 SIGNATURE 3 UP 341 197 All SZGR 2.0 genes in this pathway
TONKS TARGETS OF RUNX1 RUNX1T1 FUSION MONOCYTE UP 204 140 All SZGR 2.0 genes in this pathway
KINSEY TARGETS OF EWSR1 FLII FUSION UP 1278 748 All SZGR 2.0 genes in this pathway
DODD NASOPHARYNGEAL CARCINOMA DN 1375 806 All SZGR 2.0 genes in this pathway
LINDGREN BLADDER CANCER CLUSTER 3 UP 329 196 All SZGR 2.0 genes in this pathway
MCBRYAN PUBERTAL TGFB1 TARGETS UP 169 127 All SZGR 2.0 genes in this pathway
LASTOWSKA NEUROBLASTOMA COPY NUMBER DN 800 473 All SZGR 2.0 genes in this pathway
YANG BREAST CANCER ESR1 LASER DN 50 38 All SZGR 2.0 genes in this pathway
PUJANA BRCA1 PCC NETWORK 1652 1023 All SZGR 2.0 genes in this pathway
BUYTAERT PHOTODYNAMIC THERAPY STRESS DN 637 377 All SZGR 2.0 genes in this pathway
WEI MIR34A TARGETS 148 97 All SZGR 2.0 genes in this pathway
UEDA PERIFERAL CLOCK 169 111 All SZGR 2.0 genes in this pathway
ROSS AML WITH MLL FUSIONS 78 45 All SZGR 2.0 genes in this pathway
BYSTRYKH HEMATOPOIESIS STEM CELL QTL TRANS 882 572 All SZGR 2.0 genes in this pathway
PENG RAPAMYCIN RESPONSE DN 245 154 All SZGR 2.0 genes in this pathway
PENG GLUTAMINE DEPRIVATION DN 337 230 All SZGR 2.0 genes in this pathway
DEBIASI APOPTOSIS BY REOVIRUS INFECTION UP 314 201 All SZGR 2.0 genes in this pathway
WANG SMARCE1 TARGETS DN 371 218 All SZGR 2.0 genes in this pathway
RODWELL AGING KIDNEY NO BLOOD DN 150 93 All SZGR 2.0 genes in this pathway
RUAN RESPONSE TO TNF DN 84 50 All SZGR 2.0 genes in this pathway
BLALOCK ALZHEIMERS DISEASE UP 1691 1088 All SZGR 2.0 genes in this pathway
RODWELL AGING KIDNEY DN 145 88 All SZGR 2.0 genes in this pathway
BURTON ADIPOGENESIS 5 126 78 All SZGR 2.0 genes in this pathway
JIANG HYPOXIA NORMAL 311 205 All SZGR 2.0 genes in this pathway
MARSON BOUND BY FOXP3 UNSTIMULATED 1229 713 All SZGR 2.0 genes in this pathway
MARSON BOUND BY E2F4 UNSTIMULATED 728 415 All SZGR 2.0 genes in this pathway
WONG MITOCHONDRIA GENE MODULE 217 122 All SZGR 2.0 genes in this pathway
SMID BREAST CANCER BASAL UP 648 398 All SZGR 2.0 genes in this pathway
RAY TUMORIGENESIS BY ERBB2 CDC25A DN 159 105 All SZGR 2.0 genes in this pathway
WINTER HYPOXIA METAGENE 242 168 All SZGR 2.0 genes in this pathway
WANG TUMOR INVASIVENESS UP 374 247 All SZGR 2.0 genes in this pathway
MOOTHA HUMAN MITODB 6 2002 429 260 All SZGR 2.0 genes in this pathway
MOOTHA MITOCHONDRIA 447 277 All SZGR 2.0 genes in this pathway
YOSHIMURA MAPK8 TARGETS UP 1305 895 All SZGR 2.0 genes in this pathway
ROSS LEUKEMIA WITH MLL FUSIONS 78 49 All SZGR 2.0 genes in this pathway
AGUIRRE PANCREATIC CANCER COPY NUMBER DN 238 145 All SZGR 2.0 genes in this pathway
VALK AML CLUSTER 16 26 17 All SZGR 2.0 genes in this pathway
BOYAULT LIVER CANCER SUBCLASS G1 DN 40 26 All SZGR 2.0 genes in this pathway
YAGI AML WITH T 9 11 TRANSLOCATION 130 87 All SZGR 2.0 genes in this pathway
八木AML和11 q23处重新安排 351 238 All SZGR 2.0 genes in this pathway
RUAN RESPONSE TO TROGLITAZONE DN 19 14 All SZGR 2.0 genes in this pathway
MARTENS TRETINOIN RESPONSE DN 841 431 All SZGR 2.0 genes in this pathway
PILON KLF1 TARGETS DN 1972 1213 All SZGR 2.0 genes in this pathway
JOHNSTONE PARVB TARGETS 2 DN 336 211 All SZGR 2.0 genes in this pathway
LEE BMP2 TARGETS DN 882 538 All SZGR 2.0 genes in this pathway
WAKABAYASHI ADIPOGENESIS PPARG BOUND 8D 658 397 All SZGR 2.0 genes in this pathway
PECE MAMMARY STEM CELL DN 146 88 All SZGR 2.0 genes in this pathway

部分VI. microRNA annotation

miRNA family Target position miRNA ID miRNA seq
UTR start UTR end Match method
miR-103/107 861 867 m8 hsa-miR-103brain AGCAGCAUUGUACAGGGCUAUGA
hsa-miR-107brain AGCAGCAUUGUACAGGGCUAUCA
miR-124/506 840 846 m8 hsa-miR-506 UAAGGCACCCUUCUGAGUAGA
hsa-miR-124brain UAAGGCACGCGGUGAAUGCC
miR-128 814 821 1A,m8 hsa-miR-128a UCACAGUGAACCGGUCUCUUUU
hsa-miR-128b UCACAGUGAACCGGUCUCUUUC
miR-27 815 821 m8 hsa-miR-27abrain UUCACAGUGGCUAAGUUCCGC
hsa-miR-27bbrain UUCACAGUGGCUAAGUUCUGC