Gene Page:EPHA3

Summary?
GeneID 2042
Symbol EPHA3
Synonyms EK4|ETK|ETK1|HEK|HEK4|TYRO4
Description EPH receptor A3
Reference MIM:179611|HGNC:HGNC:3387|Ensembl:ENSG00000044524|HPRD:01555|Vega:OTTHUMG00000159040
Gene type protein-coding
Map location 3p11.2
Pascal p-value 0.291
Fetal beta 3.303

Gene in Data Sources
Gene set name Method of gene set Description Info
CV:PGCnp Genome-wide Association Study GWAS
PMID:cooccur High-throughput literature-search Systematic search in PubMed for genes co-occurring with SCZ keywords. A total of 3027 genes were included.
GSMA_IIA Genome scan meta-analysis (All samples) Psr: 0.04047
GSMA_IIE Genome scan meta-analysis (European-ancestry samples) Psr: 0.04359
Literature High-throughput literature-search Co-occurance with Schizophrenia keywords: schizophrenia,schizophrenias Click to show details

Section I. Genetics and epigenetics annotation


Section II. Transcriptome annotation

General gene expression (GTEx)

Not available

Gene expression during devlopment (BrainCloud)

Footnote:
A total of 269 time points ploted, with n=38 fetal samples (x=1:38). Each triangle represents one time point.

Gene expression of temporal and spatial changes (BrainSpan)

Footnote:
SC: sub-cortical regions; SM: sensory-motor regions; FC: frontal cortex; and TP: temporal-parietal cortex
ST1: fetal (13 - 26 postconception weeks), ST2: early infancy to late childhood (4 months to 11 years), and ST3: adolescence to adulthood (13 - 23 years)
The bar shown representes the lower 25% and upper 25% of the expression distribution.

Top co-expressed genes in brain regions

Top 10 positively co-expressed genes
Gene Pearson's Correlation Spearman's Correlation
DGAT1 0.77 0.72
FBXO17 0.75 0.75
TMEM161A 0.75 0.78
LRRC4B 0.75 0.73
RNF126 0.74 0.75
TMEM180 0.74 0.72
CHST12 0.74 0.72
AGPAT1 0.74 0.73
VAC14 0.74 0.71
SCAP 0.73 0.71
Top 10 negatively co-expressed genes
Gene Pearson's Correlation Spearman's Correlation
AF347015.21 -0.55 -0.52
AL139819.3 -0.53 -0.55
AF347015.8 -0.51 -0.47
AF347015.31 -0.50 -0.46
AF347015.27 -0.49 -0.48
MT-ATP8 -0.49 -0.49
MT-CO2 -0.49 -0.45
MT-CYB -0.48 -0.44
NOSTRIN -0.47 -0.42
AF347015.18 -0.46 -0.51

Section III. Gene Ontology annotation

Molecular function GO term Evidence Neuro keywords PubMed ID
GO:0000166 nucleotide binding IEA -
GO:0004872 receptor activity IEA -
GO:0005003 ephrin receptor activity IEA -
GO:0005524 ATP结合 IEA -
GO:0016740 transferase activity IEA -
Biological process GO term Evidence Neuro keywords PubMed ID
GO:0007169 跨膜受体蛋白酪氨酸激酶团体naling pathway IEA -
GO:0006468 protein amino acid phosphorylation IEA -
GO:0007165 signal transduction TAS 1737782
Cellular component GO term Evidence Neuro keywords PubMed ID
GO:0005576 extracellular region IEA -
GO:0016020 membrane IEA -
GO:0016021 integral to membrane IEA -
GO:0005886 plasma membrane IEA -
GO:0005887 integral to plasma membrane TAS 1737782

Section IV. Protein-protein interaction annotation

Interactors Aliases B Official full name B Experimental Source PubMed ID
CRK CRKII v-crk sarcoma virus CT10 oncogene homolog (avian) - HPRD,BioGRID 11870224
EFNA1 B61 | ECKLG | EFL1 | EPLG1 | LERK1 | TNFAIP4 ephrin-A1 Reconstituted Complex BioGRID 9195962
EFNA2 ELF-1 | EPLG6 | HEK7-L | LERK6 ephrin-A2 - HPRD 9751130
EFNA3 EFL2 | EPLG3 | Ehk1-L | LERK3 ephrin-A3 Reconstituted Complex BioGRID 9195962
EFNA4 EFL4 | EPLG4 | LERK4 | MGC125826 ephrin-A4 Reconstituted Complex BioGRID 9195962
EFNA5 AF1 | EFL5 | EPLG7 | GLC1M | LERK7 | RAGS ephrin-A5 - HPRD,BioGRID 9195962
EFNA5 AF1 | EFL5 | EPLG7 | GLC1M | LERK7 | RAGS ephrin-A5 - HPRD 9195962|9751130
EFNB1 CFND | CFNS | EFL3 | EPLG2 | Elk-L | LERK2 | MGC8782 ephrin-B1 Reconstituted Complex BioGRID 9195962
EFNB2 EPLG5 | HTKL | Htk-L | LERK5 | MGC126226 | MGC126227 | MGC126228 ephrin-B2 - HPRD,BioGRID 8559144
RUFY1 FLJ22251 | RABIP4 | ZFYVE12 RUN and FYVE domain containing 1 - HPRD 11877430
RUFY2 FLJ10063 | KIAA1537 | RABIP4R | ZFYVE13 RUN and FYVE domain containing 2 - HPRD 11877430
TP53 FLJ92943 | LFS1 | TRP53 | p53 tumor protein p53 Reconstituted Complex BioGRID 15355990


Section V. Pathway annotation

Pathway name Pathway size # SZGR 2.0 genes in pathway Info
KEGG AXON GUIDANCE 129 103 All SZGR 2.0 genes in this pathway
PID EPHA FWDPATHWAY 34 29 All SZGR 2.0 genes in this pathway
BERTUCCI MEDULLARY VS DUCTAL BREAST CANCER DN 169 118 All SZGR 2.0 genes in this pathway
DAVICIONI TARGETS OF PAX FOXO1 FUSIONS UP 255 177 All SZGR 2.0 genes in this pathway
THUM SYSTOLIC HEART FAILURE UP 423 283 All SZGR 2.0 genes in this pathway
KINSEY TARGETS OF EWSR1 FLII FUSION DN 329 219 All SZGR 2.0 genes in this pathway
SABATES COLORECTAL ADENOMA DN 291 176 All SZGR 2.0 genes in this pathway
GOZGIT ESR1 TARGETS DN 781 465 All SZGR 2.0 genes in this pathway
DELYS THYROID CANCER DN 232 154 All SZGR 2.0 genes in this pathway
LI CISPLATIN RESISTANCE UP 28 20 All SZGR 2.0 genes in this pathway
MARTORIATI MDM4 TARGETS FETAL LIVER DN 514 319 All SZGR 2.0 genes in this pathway
NUYTTEN NIPP1 TARGETS UP 769 437 All SZGR 2.0 genes in this pathway
SCHAEFFER PROSTATE DEVELOPMENT 12HR UP 116 79 All SZGR 2.0 genes in this pathway
SCHAEFFER PROSTATE DEVELOPMENT 48HR UP 487 286 All SZGR 2.0 genes in this pathway
BENPORATH ES WITH H3K27ME3 1118 744 All SZGR 2.0 genes in this pathway
MORI SMALL PRE BII LYMPHOCYTE UP 86 57 All SZGR 2.0 genes in this pathway
DING LUNG CANCER MUTATED SIGNIFICANTLY 26 22 All SZGR 2.0 genes in this pathway
MATSUDA NATURAL KILLER DIFFERENTIATION 475 313 All SZGR 2.0 genes in this pathway
HILLION HMGA1B TARGETS 92 68 All SZGR 2.0 genes in this pathway
YEGNASUBRAMANIAN PROSTATE CANCER 128 60 All SZGR 2.0 genes in this pathway
HELLER HDAC TARGETS SILENCED BY METHYLATION UP 461 298 All SZGR 2.0 genes in this pathway
DE YY1 TARGETS DN 92 64 All SZGR 2.0 genes in this pathway
RIGGI EWING SARCOMA PROGENITOR UP 430 288 All SZGR 2.0 genes in this pathway
SMID BREAST CANCER RELAPSE IN BONE UP 97 61 All SZGR 2.0 genes in this pathway
SMID BREAST CANCER BASAL DN 701 446 All SZGR 2.0 genes in this pathway
BOQUEST STEM CELL CULTURED VS FRESH UP 425 298 All SZGR 2.0 genes in this pathway
YAUCH HEDGEHOG SIGNALING PARACRINE UP 149 85 All SZGR 2.0 genes in this pathway
VART KSHV INFECTION ANGIOGENIC MARKERS UP 165 118 All SZGR 2.0 genes in this pathway
VART KSHV INFECTION ANGIOGENIC MARKERS DN 138 92 All SZGR 2.0 genes in this pathway
MEISSNER BRAIN HCP WITH H3K4ME3 AND H3K27ME3 1069 729 All SZGR 2.0 genes in this pathway
WOO LIVER CANCER RECURRENCE UP 105 75 All SZGR 2.0 genes in this pathway
CHANDRAN METASTASIS DN 306 191 All SZGR 2.0 genes in this pathway
BRUINS UVC RESPONSE VIA TP53 GROUP B 549 316 All SZGR 2.0 genes in this pathway
YANG BCL3 TARGETS UP 364 236 All SZGR 2.0 genes in this pathway
PLASARI NFIC TARGETS BASAL DN 18 13 All SZGR 2.0 genes in this pathway
ACEVEDO FGFR1 TARGETS IN PROSTATE CANCER MODEL DN 308 187 All SZGR 2.0 genes in this pathway

Section VI. microRNA annotation

miRNA family Target position miRNA ID miRNA seq
UTR start UTR end Match method
let-7/98 460 466 1A hsa-let-7abrain UGAGGUAGUAGGUUGUAUAGUU
hsa-let-7bbrain UGAGGUAGUAGGUUGUGUGGUU
hsa-let-7cbrain UGAGGUAGUAGGUUGUAUGGUU
hsa-let-7dbrain AGAGGUAGUAGGUUGCAUAGU
hsa-let-7ebrain UGAGGUAGGAGGUUGUAUAGU
hsa-let-7fbrain UGAGGUAGUAGAUUGUAUAGUU
hsa-miR-98brain UGAGGUAGUAAGUUGUAUUGUU
hsa-let-7gSZ UGAGGUAGUAGUUUGUACAGU
hsa-let-7ibrain UGAGGUAGUAGUUUGUGCUGU
miR-124.1 135 142 1A,m8 hsa-miR-124a UUAAGGCACGCGGUGAAUGCCA
miR-124/506 135 141 1A hsa-miR-506 UAAGGCACCCUUCUGAGUAGA
hsa-miR-124brain UAAGGCACGCGGUGAAUGCC
miR-135 2452 2458 m8 hsa-miR-135a UAUGGCUUUUUAUUCCUAUGUGA
hsa-miR-135b UAUGGCUUUUCAUUCCUAUGUG
miR-182 712 718 1A hsa-miR-182 UUUGGCAAUGGUAGAACUCACA
miR-194 699 705 1A hsa-miR-194 UGUAACAGCAACUCCAUGUGGA
miR-29 976 982 m8 hsa-miR-29aSZ UAGCACCAUCUGAAAUCGGUU
hsa-miR-29bSZ UAGCACCAUUUGAAAUCAGUGUU
hsa-miR-29cSZ UAGCACCAUUUGAAAUCGGU
miR-325 2272 2278 1A hsa-miR-325 CCUAGUAGGUGUCCAGUAAGUGU
miR-381 930 936 m8 hsa-miR-381 UAUACAAGGGCAAGCUCUCUGU
miR-487b 2245 2251 m8 hsa-miR-487b AAUCGUACAGGGUCAUCCACUU
miR-488 470 476 m8 hsa-miR-488 CCCAGAUAAUGGCACUCUCAA
miR-495 697 703 1A hsa-miR-495brain AAACAAACAUGGUGCACUUCUUU
miR-496 2558 2564 1A hsa-miR-496 AUUACAUGGCCAAUCUC
hsa-miR-496 AUUACAUGGCCAAUCUC
hsa-miR-496 AUUACAUGGCCAAUCUC
miR-7 1296 1303 1A,m8 hsa-miR-7SZ UGGAAGACUAGUGAUUUUGUUG
miR-96 711 718 1A,m8 hsa-miR-96brain UUUGGCACUAGCACAUUUUUGC