Gene Page:EPHB1

总结?
GeneID 2047
Symbol EPHB1
Synonyms ELK|EPHT2|Hek6|NET
Description EPH receptor B1
Reference MIM:600600|HGNC:HGNC:3392|Ensembl:ENSG00000154928|HPRD:02790|Vega:OTTHUMG00000159804
Gene type protein-coding
Map location 3q22.2
Pascal p-value 0.33
Fetal beta 0.873
eGene Cerebellum
Myers' cis & trans

Gene in Data Sources
Gene set name Method of gene set Description Info
CV:GWASdb Genome-wide Association Studies GWASdb records for schizophrenia
CV:PGCnp Genome-wide Association Study GWAS
PMID:cooccur High-throughput literature-search Systematic search in PubMed for genes co-occurring with SCZ keywords. A total of 3027 genes were included.
Literature High-throughput literature-search Co-occurance with Schizophrenia keywords: schizophrenia,schizophrenic,schizophrenias Click to show details
GO_Annotation Mapping neuro-related keywords to Gene Ontology annotations Hits with neuro-related keywords: 1

Section I. Genetics and epigenetics annotation

@eQTL annotation

SNP ID Chromosome Position eGene Gene Entrez ID pvalue qvalue TSS distance eQTL type
rs16829545 chr2 151977407 EPHB1 2047 2.844E-14 trans
rs7584986 chr2 184111432 EPHB1 2047 0 trans
rs6741060 chr2 217169088 EPHB1 2047 0.06 trans
snp_a-1815771 0 EPHB1 2047 0.01 trans
rs17020035 chr4 93873810 EPHB1 2047 0.15 trans
rs17020058 chr4 93915972 EPHB1 2047 0.15 trans
rs17020066 chr4 93921055 EPHB1 2047 0.15 trans
rs10491487 chr5 80323367 EPHB1 2047 0.09 trans
rs6996695 chr8 77540580 EPHB1 2047 0.16 trans
rs11139334 chr9 84209393 EPHB1 2047 9.877E-4 trans
rs2393316 chr10 59333070 EPHB1 2047 0.1 trans
rs11061703 chr12 1436977 EPHB1 2047 0.11 trans
rs9989228 chr14 37809252 EPHB1 2047 0.03 trans
rs16955618 chr15 29937543 EPHB1 2047 5.685E-10 trans
rs2077735 chr15 58479024 EPHB1 2047 0 trans
rs9941296 chr16 2759498 EPHB1 2047 0.17 trans
rs11873184 chr18 1584081 EPHB1 2047 0.07 trans

Section II. Transcriptome annotation

General gene expression (GTEx)

Not available

Gene expression during devlopment (BrainCloud)

Footnote:
A total of 269 time points ploted, with n=38 fetal samples (x=1:38). Each triangle represents one time point.

Gene expression of temporal and spatial changes (BrainSpan)

Footnote:
SC: sub-cortical regions; SM: sensory-motor regions; FC: frontal cortex; and TP: temporal-parietal cortex
ST1: fetal (13 - 26 postconception weeks), ST2: early infancy to late childhood (4 months to 11 years), and ST3: adolescence to adulthood (13 - 23 years)
The bar shown representes the lower 25% and upper 25% of the expression distribution.

No co-expressed genes in brain regions


Section III. Gene Ontology annotation

Molecular function GO term Evidence Neuro keywords PubMed ID
GO:0000166 nucleotide binding IEA -
GO:0004872 receptor activity IEA -
GO:0005003 ephrin receptor activity IEA -
GO:0005515 protein binding IPI 8798570
GO:0005524 ATP binding IEA -
GO:0016740 transferase activity IEA -
Biological process GO term Evidence Neuro keywords PubMed ID
GO:0007399 nervous system development TAS neurite (GO term level: 5) 8666391
GO:0007169 跨膜受体蛋白酪氨酸激酶团体naling pathway IEA -
GO:0006468 protein amino acid phosphorylation IEA -
GO:0007165 signal transduction TAS 8666391
Cellular component GO term Evidence Neuro keywords PubMed ID
GO:0005886 plasma membrane TAS 8666391
GO:0005887 integral to plasma membrane TAS 8666391

Section V. Pathway annotation

Pathway name Pathway size # SZGR 2.0 genes in pathway Info
KEGG AXON GUIDANCE 129 103 All SZGR 2.0 genes in this pathway
BIOCARTA EPHA4 PATHWAY 10 8 All SZGR 2.0 genes in this pathway
PID EPHB FWD PATHWAY 40 38 All SZGR 2.0 genes in this pathway
PID EPHRINB REV PATHWAY 30 25 All SZGR 2.0 genes in this pathway
DOANE RESPONSE TO ANDROGEN UP 184 125 All SZGR 2.0 genes in this pathway
SENESE HDAC1 AND HDAC2 TARGETS UP 238 144 All SZGR 2.0 genes in this pathway
YEMELYANOV GR TARGETS DN 10 8 All SZGR 2.0 genes in this pathway
SCHAEFFER PROSTATE DEVELOPMENT 48HR DN 428 306 All SZGR 2.0 genes in this pathway
BENPORATH SUZ12 TARGETS 1038 678 All SZGR 2.0 genes in this pathway
BENPORATH EED TARGETS 1062 725 All SZGR 2.0 genes in this pathway
BENPORATH ES WITH H3K27ME3 1118 744 All SZGR 2.0 genes in this pathway
BENPORATH PRC2 TARGETS 652 441 All SZGR 2.0 genes in this pathway
ZHAN MULTIPLE MYELOMA HP UP 49 26 All SZGR 2.0 genes in this pathway
CUI TCF21 TARGETS 2 DN 830 547 All SZGR 2.0 genes in this pathway
KIM GASTRIC CANCER CHEMOSENSITIVITY 103 64 All SZGR 2.0 genes in this pathway
LEIN MIDBRAIN MARKERS 82 55 All SZGR 2.0 genes in this pathway
里奇尤因肉瘤祖 430 288 All SZGR 2.0 genes in this pathway
ZHENG GLIOBLASTOMA PLASTICITY DN 58 39 All SZGR 2.0 genes in this pathway
FIRESTEIN PROLIFERATION 175 125 All SZGR 2.0 genes in this pathway
VART KSHV INFECTION ANGIOGENIC MARKERS UP 165 118 All SZGR 2.0 genes in this pathway
MIKKELSEN MCV6 HCP WITH H3K27ME3 435 318 All SZGR 2.0 genes in this pathway
VERHAAK GLIOBLASTOMA PRONEURAL 177 132 All SZGR 2.0 genes in this pathway
LIM MAMMARY STEM CELL UP 489 314 All SZGR 2.0 genes in this pathway

Section VI. microRNA annotation

miRNA family Target position miRNA ID miRNA seq
UTR start UTR end Match method
miR-129-5p 661 667 m8 hsa-miR-129brain CUUUUUGCGGUCUGGGCUUGC
hsa-miR-129-5p CUUUUUGCGGUCUGGGCUUGCU
miR-140 676 683 1A,m8 hsa-miR-140brain AGUGGUUUUACCCUAUGGUAG
miR-182 541 548 1A,m8 hsa-miR-182 UUUGGCAAUGGUAGAACUCACA
miR-186 399 405 m8 hsa-miR-186 CAAAGAAUUCUCCUUUUGGGCUU
miR-28 509 515 m8 hsa-miR-28brain AAGGAGCUCACAGUCUAUUGAG
miR-450 661 667 1A hsa-miR-450 UUUUUGCGAUGUGUUCCUAAUA
miR-452 781 788 1A,m8 hsa-miR-452 UGUUUGCAGAGGAAACUGAGAC
miR-539 1266 1272 m8 hsa-miR-539 GGAGAAAUUAUCCUUGGUGUGU
mir - 96 542 548 1A hsa-miR-96brain UUUGGCACUAGCACAUUUUUGC