Gene Page:FAP

Summary?
GeneID 2191
Symbol FAP
Synonyms DPPIV|FAPA|SIMP
Description fibroblast activation protein alpha
Reference MIM:600403|HGNC:HGNC:3590|Ensembl:ENSG00000078098|HPRD:02674|Vega:OTTHUMG00000153890
Gene type protein-coding
Map location 2q23
Pascal p-value 0.178
Sherlock p-value 0.359
Fetal beta -0.604
eGene Myers' cis & trans

Gene in Data Sources
Gene set name Method of gene set Description Info
CV:PGCnp Genome-wide Association Study GWAS
PMID:cooccur High-throughput literature-search Systematic search in PubMed for genes co-occurring with SCZ keywords. A total of 3027 genes were included.
GSMA_IIA Genome scan meta-analysis (All samples) Psr: 0.02395
Literature High-throughput literature-search Co-occurance与精神分裂症ophrenia keywords: schizophrenia,schizophrenic,schizophrenias Click to show details
GO_Annotation Mapping neuro-related keywords to Gene Ontology annotations Hits with neuro-related keywords: 1

Section I. Genetics and epigenetics annotation

@eQTL annotation

SNP ID Chromosome Position eGene Gene Entrez ID pvalue qvalue TSS distance eQTL type
rs10490422 chr2 162916412 FAP 2191 0.15 cis
rs16896683 chr6 43687846 FAP 2191 0.02 trans
rs11982157 chr7 84206518 FAP 2191 0.17 trans
rs2372175 chr7 84219230 FAP 2191 0.12 trans

Section II. Transcriptome annotation

General gene expression (GTEx)

Not available

Gene expression during devlopment (BrainCloud)

Footnote:
A total of 269 time points ploted, with n=38 fetal samples (x=1:38). Each triangle represents one time point.

Gene expression of temporal and spatial changes (BrainSpan)

Footnote:
SC: sub-cortical regions; SM: sensory-motor regions; FC: frontal cortex; and TP: temporal-parietal cortex
ST1: fetal (13 - 26 postconception weeks), ST2: early infancy to late childhood (4 months to 11 years), and ST3: adolescence to adulthood (13 - 23 years)
The bar shown representes the lower 25% and upper 25% of the expression distribution.

No co-expressed genes in brain regions


Section III. Gene Ontology annotation

Molecular function GO term Evidence Neuro keywords PubMed ID
GO:0004252 serine-type endopeptidase activity IEA glutamate (GO term level: 7) -
GO:0004222 metalloendopeptidase activity TAS 9065413
GO:0008239 dipeptidyl-peptidase activity NAS 7911242
GO:0008233 peptidase activity IDA 9688278
GO:0042803 protein homodimerization activity NAS 9247085
Biological process GO term Evidence Neuro keywords PubMed ID
GO:0006508 proteolysis IEA -
Cellular component GO term Evidence Neuro keywords PubMed ID
GO:0016021 integral to membrane NAS 9065413
GO:0030027 lamellipodium IDA 9065413
GO:0005886 plasma membrane IEA -

Section V. Pathway annotation

Pathway name Pathway size # SZGR 2.0 genes in pathway Info
BERTUCCI MEDULLARY VS DUCTAL BREAST CANCER DN 169 118 All SZGR 2.0 genes in this pathway
SCHUETZ BREAST CANCER DUCTAL INVASIVE UP 351 230 All SZGR 2.0 genes in this pathway
CHARAFE BREAST CANCER LUMINAL VS BASAL DN 455 304 All SZGR 2.0 genes in this pathway
VECCHI GASTRIC CANCER ADVANCED VS EARLY UP 175 120 All SZGR 2.0 genes in this pathway
ODONNELL TFRC TARGETS DN 139 76 All SZGR 2.0 genes in this pathway
LEE NEURAL CREST STEM CELL UP 146 99 All SZGR 2.0 genes in this pathway
DELYS THYROID CANCER UP 443 294 All SZGR 2.0 genes in this pathway
HAMAI APOPTOSIS VIA TRAIL UP 584 356 All SZGR 2.0 genes in this pathway
GRUETZMANN PANCREATIC CANCER UP 358 245 All SZGR 2.0 genes in this pathway
KARAKAS TGFB1 SIGNALING 18 15 All SZGR 2.0 genes in this pathway
SCHAEFFER PROSTATE DEVELOPMENT 6HR UP 176 115 All SZGR 2.0 genes in this pathway
SCHAEFFER PROSTATE DEVELOPMENT AND CANCER BOX2 DN 7 6 All SZGR 2.0 genes in this pathway
LEI MYB TARGETS 318 215 All SZGR 2.0 genes in this pathway
PETROVA ENDOTHELIUM LYMPHATIC VS BLOOD DN 162 102 All SZGR 2.0 genes in this pathway
PETROVA PROX1 TARGETS DN 64 38 All SZGR 2.0 genes in this pathway
REN ALVEOLAR RHABDOMYOSARCOMA DN 408 274 All SZGR 2.0 genes in this pathway
WESTON VEGFA TARGETS 6HR 59 38 All SZGR 2.0 genes in this pathway
RHODES CANCER META SIGNATURE 64 47 All SZGR 2.0 genes in this pathway
CUI TCF21 TARGETS UP 37 27 All SZGR 2.0 genes in this pathway
KRASNOSELSKAYA ILF3 TARGETS UP 38 24 All SZGR 2.0 genes in this pathway
LINDVALL IMMORTALIZED BY TERT DN 80 56 All SZGR 2.0 genes in this pathway
BROWNE HCMV INFECTION 48HR DN 504 323 All SZGR 2.0 genes in this pathway
WESTON VEGFA TARGETS 108 71 All SZGR 2.0 genes in this pathway
CUI TCF21 TARGETS 2 UP 428 266 All SZGR 2.0 genes in this pathway
KAYO CALORIE RESTRICTION MUSCLE UP 95 64 All SZGR 2.0 genes in this pathway
TSENG IRS1 TARGETS UP 113 71 All SZGR 2.0 genes in this pathway
WANG SMARCE1 TARGETS UP 280 183 All SZGR 2.0 genes in this pathway
BOQUEST STEM CELL UP 260 174 All SZGR 2.0 genes in this pathway
BHATI G2M ARREST BY 2METHOXYESTRADIOL UP 125 68 All SZGR 2.0 genes in this pathway
CROMER TUMORIGENESIS UP 63 36 All SZGR 2.0 genes in this pathway
POOLA INVASIVE BREAST CANCER UP 288 168 All SZGR 2.0 genes in this pathway
NAKAYAMA SOFT TISSUE TUMORS PCA1 UP 76 46 All SZGR 2.0 genes in this pathway
国外RB1增长目标 243 155 All SZGR 2.0 genes in this pathway
CHICAS RB1 TARGETS CONFLUENT 567 365 All SZGR 2.0 genes in this pathway
PECE MAMMARY STEM CELL DN 146 88 All SZGR 2.0 genes in this pathway
ANASTASSIOU CANCER MESENCHYMAL TRANSITION SIGNATURE 64 40 All SZGR 2.0 genes in this pathway
FARMER BREAST CANCER CLUSTER 4 19 12 All SZGR 2.0 genes in this pathway

Section VI. microRNA annotation

miRNA family Target position miRNA ID miRNA seq
UTR start UTR end Match method
miR-30-5p 173 180 1A,m8 hsa-miR-30a-5p UGUAAACAUCCUCGACUGGAAG
hsa-miR-30cbrain UGUAAACAUCCUACACUCUCAGC
hsa-miR-30dSZ UGUAAACAUCCCCGACUGGAAG
hsa-miR-30bSZ UGUAAACAUCCUACACUCAGCU
hsa-miR-30e-5p UGUAAACAUCCUUGACUGGA