Gene Page:FAP
Summary?
GeneID | 2191 |
Symbol | FAP |
Synonyms | DPPIV|FAPA|SIMP |
Description | fibroblast activation protein alpha |
Reference | MIM:600403|HGNC:HGNC:3590|Ensembl:ENSG00000078098|HPRD:02674|Vega:OTTHUMG00000153890 |
Gene type | protein-coding |
Map location | 2q23 |
Pascal p-value | 0.178 |
Sherlock p-value | 0.359 |
Fetal beta | -0.604 |
eGene | Myers' cis & trans |
Gene in Data Sources
Gene set name | Method of gene set | Description | Info |
---|---|---|---|
CV:PGCnp | Genome-wide Association Study | GWAS | |
PMID:cooccur | High-throughput literature-search | Systematic search in PubMed for genes co-occurring with SCZ keywords. A total of 3027 genes were included. | |
GSMA_IIA | Genome scan meta-analysis (All samples) | Psr: 0.02395 | |
Literature | High-throughput literature-search | Co-occurance与精神分裂症ophrenia keywords: schizophrenia,schizophrenic,schizophrenias | Click to show details |
GO_Annotation | Mapping neuro-related keywords to Gene Ontology annotations | Hits with neuro-related keywords: 1 |
Section I. Genetics and epigenetics annotation
eQTL annotation
SNP ID | Chromosome | Position | eGene | Gene Entrez ID | pvalue | qvalue | TSS distance | eQTL type |
---|---|---|---|---|---|---|---|---|
rs10490422 | chr2 | 162916412 | FAP | 2191 | 0.15 | cis | ||
rs16896683 | chr6 | 43687846 | FAP | 2191 | 0.02 | trans | ||
rs11982157 | chr7 | 84206518 | FAP | 2191 | 0.17 | trans | ||
rs2372175 | chr7 | 84219230 | FAP | 2191 | 0.12 | trans |
Section II. Transcriptome annotation
General gene expression (GTEx)
![Not available](http://www.tjghsg.com/bioinfo/SZGR/GeneImg/FAP_DE_GTEx.png)
Gene expression during devlopment (BrainCloud)
Footnote:
A total of 269 time points ploted, with n=38 fetal samples (x=1:38). Each triangle represents one time point.
Gene expression of temporal and spatial changes (BrainSpan)
Footnote:
SC: sub-cortical regions; SM: sensory-motor regions; FC: frontal cortex; and TP: temporal-parietal cortex
ST1: fetal (13 - 26 postconception weeks), ST2: early infancy to late childhood (4 months to 11 years), and ST3: adolescence to adulthood (13 - 23 years)
The bar shown representes the lower 25% and upper 25% of the expression distribution.
No co-expressed genes in brain regions
Section III. Gene Ontology annotation
Molecular function | GO term | Evidence | Neuro keywords | PubMed ID |
---|---|---|---|---|
GO:0004252 | serine-type endopeptidase activity | IEA | glutamate (GO term level: 7) | - |
GO:0004222 | metalloendopeptidase activity | TAS | 9065413 | |
GO:0008239 | dipeptidyl-peptidase activity | NAS | 7911242 | |
GO:0008233 | peptidase activity | IDA | 9688278 | |
GO:0042803 | protein homodimerization activity | NAS | 9247085 | |
Biological process | GO term | Evidence | Neuro keywords | PubMed ID |
GO:0006508 | proteolysis | IEA | - | |
Cellular component | GO term | Evidence | Neuro keywords | PubMed ID |
GO:0016021 | integral to membrane | NAS | 9065413 | |
GO:0030027 | lamellipodium | IDA | 9065413 | |
GO:0005886 | plasma membrane | IEA | - |
Section V. Pathway annotation
Pathway name | Pathway size | # SZGR 2.0 genes in pathway | Info |
---|---|---|---|
BERTUCCI MEDULLARY VS DUCTAL BREAST CANCER DN | 169 | 118 | All SZGR 2.0 genes in this pathway |
SCHUETZ BREAST CANCER DUCTAL INVASIVE UP | 351 | 230 | All SZGR 2.0 genes in this pathway |
CHARAFE BREAST CANCER LUMINAL VS BASAL DN | 455 | 304 | All SZGR 2.0 genes in this pathway |
VECCHI GASTRIC CANCER ADVANCED VS EARLY UP | 175 | 120 | All SZGR 2.0 genes in this pathway |
ODONNELL TFRC TARGETS DN | 139 | 76 | All SZGR 2.0 genes in this pathway |
LEE NEURAL CREST STEM CELL UP | 146 | 99 | All SZGR 2.0 genes in this pathway |
DELYS THYROID CANCER UP | 443 | 294 | All SZGR 2.0 genes in this pathway |
HAMAI APOPTOSIS VIA TRAIL UP | 584 | 356 | All SZGR 2.0 genes in this pathway |
GRUETZMANN PANCREATIC CANCER UP | 358 | 245 | All SZGR 2.0 genes in this pathway |
KARAKAS TGFB1 SIGNALING | 18 | 15 | All SZGR 2.0 genes in this pathway |
SCHAEFFER PROSTATE DEVELOPMENT 6HR UP | 176 | 115 | All SZGR 2.0 genes in this pathway |
SCHAEFFER PROSTATE DEVELOPMENT AND CANCER BOX2 DN | 7 | 6 | All SZGR 2.0 genes in this pathway |
LEI MYB TARGETS | 318 | 215 | All SZGR 2.0 genes in this pathway |
PETROVA ENDOTHELIUM LYMPHATIC VS BLOOD DN | 162 | 102 | All SZGR 2.0 genes in this pathway |
PETROVA PROX1 TARGETS DN | 64 | 38 | All SZGR 2.0 genes in this pathway |
REN ALVEOLAR RHABDOMYOSARCOMA DN | 408 | 274 | All SZGR 2.0 genes in this pathway |
WESTON VEGFA TARGETS 6HR | 59 | 38 | All SZGR 2.0 genes in this pathway |
RHODES CANCER META SIGNATURE | 64 | 47 | All SZGR 2.0 genes in this pathway |
CUI TCF21 TARGETS UP | 37 | 27 | All SZGR 2.0 genes in this pathway |
KRASNOSELSKAYA ILF3 TARGETS UP | 38 | 24 | All SZGR 2.0 genes in this pathway |
LINDVALL IMMORTALIZED BY TERT DN | 80 | 56 | All SZGR 2.0 genes in this pathway |
BROWNE HCMV INFECTION 48HR DN | 504 | 323 | All SZGR 2.0 genes in this pathway |
WESTON VEGFA TARGETS | 108 | 71 | All SZGR 2.0 genes in this pathway |
CUI TCF21 TARGETS 2 UP | 428 | 266 | All SZGR 2.0 genes in this pathway |
KAYO CALORIE RESTRICTION MUSCLE UP | 95 | 64 | All SZGR 2.0 genes in this pathway |
TSENG IRS1 TARGETS UP | 113 | 71 | All SZGR 2.0 genes in this pathway |
WANG SMARCE1 TARGETS UP | 280 | 183 | All SZGR 2.0 genes in this pathway |
BOQUEST STEM CELL UP | 260 | 174 | All SZGR 2.0 genes in this pathway |
BHATI G2M ARREST BY 2METHOXYESTRADIOL UP | 125 | 68 | All SZGR 2.0 genes in this pathway |
CROMER TUMORIGENESIS UP | 63 | 36 | All SZGR 2.0 genes in this pathway |
POOLA INVASIVE BREAST CANCER UP | 288 | 168 | All SZGR 2.0 genes in this pathway |
NAKAYAMA SOFT TISSUE TUMORS PCA1 UP | 76 | 46 | All SZGR 2.0 genes in this pathway |
国外RB1增长目标 | 243 | 155 | All SZGR 2.0 genes in this pathway |
CHICAS RB1 TARGETS CONFLUENT | 567 | 365 | All SZGR 2.0 genes in this pathway |
PECE MAMMARY STEM CELL DN | 146 | 88 | All SZGR 2.0 genes in this pathway |
ANASTASSIOU CANCER MESENCHYMAL TRANSITION SIGNATURE | 64 | 40 | All SZGR 2.0 genes in this pathway |
FARMER BREAST CANCER CLUSTER 4 | 19 | 12 | All SZGR 2.0 genes in this pathway |
Section VI. microRNA annotation
miRNA family | Target position | miRNA ID | miRNA seq | ||
---|---|---|---|---|---|
UTR start | UTR end | Match method | |||
miR-30-5p | 173 | 180 | 1A,m8 | hsa-miR-30a-5p | UGUAAACAUCCUCGACUGGAAG |
hsa-miR-30cbrain | UGUAAACAUCCUACACUCUCAGC | ||||
hsa-miR-30dSZ | UGUAAACAUCCCCGACUGGAAG | ||||
hsa-miR-30bSZ | UGUAAACAUCCUACACUCAGCU | ||||
hsa-miR-30e-5p | UGUAAACAUCCUUGACUGGA |
- SZ: miRNAs which differentially expressed in brain cortex of schizophrenia patients comparing with control samples using microarray. Clickhereto see the list of SZ related miRNAs.
- Brain: miRNAs which are expressed in brain based on miRNA microarray expression studies. Clickhereto see the list of brain related miRNAs.