Gene Page:TYSND1

Summary?
GeneID 219743
Symbol TYSND1
Synonyms NET41
Description trypsin domain containing 1
Reference MIM:611017|HGNC:HGNC:28531|Ensembl:ENSG00000156521|HPRD:15593|Vega:OTTHUMG00000018397
Gene type protein-coding
Map location 10q22.1
Pascal p-value 0.273
Sherlock p-value 0.261
Fetal beta 0.669
DMG 1 (# studies)

Gene in Data Sources
Gene set name Method of gene set Description Info
CV:PGCnp Genome-wide Association Study GWAS
DMG:Jaffe_2016 Genome-wide DNA methylation analysis This dataset includes 2,104 probes/CpGs associated with SZ patients (n=108) compared to 136 controls at Bonferroni-adjusted P < 0.05. 1
GO_Annotation Mapping neuro-related keywords to Gene Ontology annotations Hits with neuro-related keywords: 1

Section I. Genetics and epigenetics annotation

@Differentially methylated gene

Probe Chromosome Position Nearest gene P (dis) Beta (dis) FDR (dis) Study
cg18815006 10 71906516 TYSND1 2.14E-9 -0.01 1.69E-6 DMG:Jaffe_2016


Section II. Transcriptome annotation

General gene expression (GTEx)

Not available

Gene expression during devlopment (BrainCloud)

Footnote:
A total of 269 time points ploted, with n=38 fetal samples (x=1:38). Each triangle represents one time point.

Gene expression of temporal and spatial changes (BrainSpan)

Footnote:
SC: sub-cortical regions; SM: sensory-motor regions; FC: frontal cortex; and TP: temporal-parietal cortex
ST1: fetal (13 - 26 postconception weeks), ST2: early infancy to late childhood (4 months to 11 years), and ST3: adolescence to adulthood (13 - 23 years)
The bar shown representes the lower 25% and upper 25% of the expression distribution.

No co-expressed genes in brain regions


Section III. Gene Ontology annotation

Molecular function GO term Evidence Neuro keywords PubMed ID
GO:0004252 serine-type endopeptidase activity IEA glutamate (GO term level: 7) -
GO:0008233 peptidase activity IEA -
Biological process GO term Evidence Neuro keywords PubMed ID
GO:0006508 proteolysis IEA -
Cellular component GO term Evidence Neuro keywords PubMed ID
GO:0005777 peroxisome IEA -

Section V. Pathway annotation

Pathway name Pathway size # SZGR 2.0 genes in pathway Info
BERTUCCI MEDULLARY VS DUCTAL BREAST CANCER UP 206 111 All SZGR 2.0 genes in this pathway
GARY CD5 TARGETS UP 473 314 All SZGR 2.0 genes in this pathway
PEREZ TP53 TARGETS 1174 695 All SZGR 2.0 genes in this pathway
PATIL LIVER CANCER 747 453 All SZGR 2.0 genes in this pathway
MORI EMU MYC LYMPHOMA BY ONSET TIME UP 110 69 All SZGR 2.0 genes in this pathway
KEEN RESPONSE TO ROSIGLITAZONE UP 38 23 All SZGR 2.0 genes in this pathway
BURTON ADIPOGENESIS 5 126 78 All SZGR 2.0 genes in this pathway
DOUGLAS BMI1 TARGETS UP 566 371 All SZGR 2.0 genes in this pathway
ZHANG TLX TARGETS 36HR UP 221 150 All SZGR 2.0 genes in this pathway
WHITFIELD CELL CYCLE G2 182 102 All SZGR 2.0 genes in this pathway
MARTENS TRETINOIN RESPONSE DN 841 431 All SZGR 2.0 genes in this pathway
LU EZH2 TARGETS UP 295 155 All SZGR 2.0 genes in this pathway
若林史江脂肪生成PPARG RXRA 8 d 882 506 All SZGR 2.0 genes in this pathway

Section VI. microRNA annotation

miRNA family Target position miRNA ID miRNA seq
UTR start UTR end Match method
miR-124/506 619 625 m8 hsa-miR-506 UAAGGCACCCUUCUGAGUAGA
hsa-miR-124brain UAAGGCACGCGGUGAAUGCC