Gene Page:OAF

Summary?
GeneID 220323
Symbol OAF
Synonyms NS5ATP13TP2
Description out at first homolog
Reference HGNC:HGNC:28752|HPRD:17646|
Gene type protein-coding
Map location 11q23.3
Pascal p-value 8.828E-5
eGene Caudate basal ganglia
Frontal Cortex BA9
Myers' cis & trans

Gene in Data Sources
Gene set name Method of gene set Description Info
CV:PGCnp Genome-wide Association Study GWAS
GSMA_I Genome scan meta-analysis Psr: 0.006

Section I. Genetics and epigenetics annotation

@eQTL annotation

SNP ID Chromosome Position eGene Gene Entrez ID pvalue qvalue TSS distance eQTL type
rs6879593 chr5 75253310 OAF 220323 0.2 trans
rs11142564 chr9 73365108 OAF 220323 0.18 trans

Section II. Transcriptome annotation

General gene expression (GTEx)

Not available

Gene expression of temporal and spatial changes (BrainSpan)

Footnote:
SC: sub-cortical regions; SM: sensory-motor regions; FC: frontal cortex; and TP: temporal-parietal cortex
死神:胎儿(13 - 26 postconception周),ST2: early infancy to late childhood (4 months to 11 years), and ST3: adolescence to adulthood (13 - 23 years)
The bar shown representes the lower 25% and upper 25% of the expression distribution.

No co-expressed genes in brain regions


Section V. Pathway annotation

Pathway name Pathway size # SZGR 2.0 genes in pathway Info
ZHOU INFLAMMATORY RESPONSE LIVE UP 485 293 All SZGR 2.0 genes in this pathway
BENPORATH SUZ12 TARGETS 1038 678 All SZGR 2.0 genes in this pathway
BENPORATH EED TARGETS 1062 725 All SZGR 2.0 genes in this pathway
BENPORATH ES WITH H3K27ME3 1118 744 All SZGR 2.0 genes in this pathway
BENPORATH PRC2 TARGETS 652 441 All SZGR 2.0 genes in this pathway
ZHANG RESPONSE TO IKK INHIBITOR AND TNF UP 223 140 All SZGR 2.0 genes in this pathway
WANG IMMORTALIZED BY HOXA9 AND MEIS1 DN 24 15 All SZGR 2.0 genes in this pathway
MATSUDA NATURAL KILLER DIFFERENTIATION 475 313 All SZGR 2.0 genes in this pathway
MONNIER POSTRADIATION TUMOR ESCAPE DN 373 196 All SZGR 2.0 genes in this pathway
MARSON BOUND BY FOXP3 STIMULATED 1022 619 All SZGR 2.0 genes in this pathway
MARSON BOUND BY FOXP3 UNSTIMULATED 1229 713 All SZGR 2.0 genes in this pathway
ACEVEDO NORMAL TISSUE ADJACENT TO LIVER TUMOR DN 354 216 All SZGR 2.0 genes in this pathway
ACEVEDO LIVER CANCER DN 540 340 All SZGR 2.0 genes in this pathway
MCMURRAY TP53 HRAS COOPERATION RESPONSE UP 26 19 All SZGR 2.0 genes in this pathway
MEISSNER BRAIN HCP WITH H3K4ME3 AND H3K27ME3 1069 729 All SZGR 2.0 genes in this pathway
MILI PSEUDOPODIA HAPTOTAXIS DN 668 419 All SZGR 2.0 genes in this pathway
MEISSNER NPC HCP WITH H3K4ME2 AND H3K27ME3 349 234 All SZGR 2.0 genes in this pathway
MIKKELSEN MCV6 HCP WITH H3K27ME3 435 318 All SZGR 2.0 genes in this pathway
MIKKELSEN NPC HCP WITH H3K4ME3 AND H3K27ME3 210 148 All SZGR 2.0 genes in this pathway
JOHNSTONE PARVB TARGETS 2 UP 140 94 All SZGR 2.0 genes in this pathway
MIYAGAWA TARGETS OF EWSR1 ETS FUSIONS UP 259 159 All SZGR 2.0 genes in this pathway
TORCHIA TARGETS OF EWSR1 FLI1 FUSION DN 321 200 All SZGR 2.0 genes in this pathway
WAKABAYASHI ADIPOGENESIS PPARG BOUND 8D 658 397 All SZGR 2.0 genes in this pathway

Section VI. microRNA annotation

miRNA family Target position miRNA ID miRNA seq
UTR start UTR end Match method
miR-124/506 610 616 m8 hsa-miR-506 UAAGGCACCCUUCUGAGUAGA
hsa-miR-124brain UAAGGCACGCGGUGAAUGCC
miR-26 726 732 1A hsa-miR-26abrain UUCAAGUAAUCCAGGAUAGGC
hsa-miR-26bSZ UUCAAGUAAUUCAGGAUAGGUU