Gene Page:SLC39A12

Summary?
GeneID 221074
Symbol SLC39A12
Synonyms LZT-Hs8|ZIP-12|bA570F3.1
Description solute carrier family 39 (zinc transporter), member 12
Reference MIM:608734|HGNC:HGNC:20860|Ensembl:ENSG00000148482|HPRD:15384|Vega:OTTHUMG00000017759
Gene type protein-coding
Map location 10p12.33
Pascal p-value 0.146
Sherlock p-value 0.162
eGene Myers' cis & trans

Gene in Data Sources
Gene set name Method of gene set Description Info
CV:GWAScat Genome-wide Association Studies This data set includes 560 SNPs associated with schizophrenia. A total of 486 genes were mapped to these SNPs within 50kb.
CV:GWASdb Genome-wide Association Studies GWASdb records for schizophrenia
CV:PGCnp Genome-wide Association Study GWAS

Section I. Genetics and epigenetics annotation

@eQTL annotation

SNP ID Chromosome Position eGene Gene Entrez ID pvalue qvalue TSS distance eQTL type
rs11013860 chr10 18654026 SLC39A12 221074 0.05 cis
rs6879593 chr5 75253310 SLC39A12 221074 0.06 trans
rs2068673 chr12 60333402 SLC39A12 221074 0.03 trans

Section II. Transcriptome annotation

General gene expression (GTEx)

Not available

Gene expression of temporal and spatial changes (BrainSpan)

Footnote:
SC: sub-cortical regions; SM: sensory-motor regions; FC: frontal cortex; and TP: temporal-parietal cortex
ST1: fetal (13 - 26 postconception weeks), ST2: early infancy to late childhood (4 months to 11 years), and ST3: adolescence to adulthood (13 - 23 years)
The bar shown representes the lower 25% and upper 25% of the expression distribution.

No co-expressed genes in brain regions


Section III. Gene Ontology annotation

Molecular function GO term Evidence Neuro keywords PubMed ID
GO:0008270 zinc ion binding IEA -
GO:0046873 metal ion transmembrane transporter activity IEA -
Biological process GO term Evidence Neuro keywords PubMed ID
GO:0030001 metal ion transport IEA -
GO:0006829 zinc ion transport IEA -
GO:0006811 ion transport IEA -
Cellular component GO term Evidence Neuro keywords PubMed ID
GO:0016020 membrane IEA -
GO:0016021 integral to membrane IEA -

Section V. Pathway annotation

Pathway name Pathway size # SZGR 2.0 genes in pathway Info
LEIN CHOROID PLEXUS MARKERS 103 61 All SZGR 2.0 genes in this pathway
CHEN METABOLIC SYNDROM NETWORK 1210 725 All SZGR 2.0 genes in this pathway
NOUSHMEHR GBM SILENCED BY METHYLATION 50 32 All SZGR 2.0 genes in this pathway
ZWANG TRANSIENTLY UP BY 2ND EGF PULSE ONLY 1725 838 All SZGR 2.0 genes in this pathway

Section VI. microRNA annotation

miRNA family Target position miRNA ID miRNA seq
UTR start UTR end Match method
miR-543 311 317 m8 hsa-miR-543 AAACAUUCGCGGUGCACUUCU