Gene Page:NT5DC1

Summary?
GeneID 221294
Symbol NT5DC1
Synonyms C6orf200|LP2642|NT5C2L1
Description 5'-nucleotidase domain containing 1
Reference HGNC:HGNC:21556|HPRD:14845|
Gene type protein-coding
Map location 6q22.1
Pascal p-value 0.37
Fetal beta -1.716
DMG 1 (# studies)
eGene Myers' cis & trans

Gene in Data Sources
Gene set name Method of gene set Description Info
CV:PGCnp Genome-wide Association Study GWAS
DMG:Nishioka_2013 Genome-wide DNA methylation analysis The authors investigated the methylation profiles of DNA in peripheral blood cells from 18 patients with first-episode schizophrenia (FESZ) and from 15 normal controls. 1

Section I. Genetics and epigenetics annotation

@Differentially methylated gene

Probe Chromosome Position Nearest gene P (dis) Beta (dis) FDR (dis) Study
cg25179963 6 116422123 NT5DC1 -0.073 0.28 DMG:Nishioka_2013

@eQTL annotation

SNP ID Chromosome Position eGene Gene Entrez ID pvalue qvalue TSS distance eQTL type
rs17582810 chr2 75561060 NT5DC1 221294 0.14 trans
rs7567259 chr2 75568215 NT5DC1 221294 0.07 trans

Section II. Transcriptome annotation

General gene expression (GTEx)

Not available

Gene expression during devlopment (BrainCloud)

Footnote:
A total of 269 time points ploted, with n=38 fetal samples (x=1:38). Each triangle represents one time point.

Gene expression of temporal and spatial changes (BrainSpan)

Footnote:
SC: sub-cortical regions; SM: sensory-motor regions; FC: frontal cortex; and TP: temporal-parietal cortex
死神:胎儿(13 -26 postconception weeks), ST2: early infancy to late childhood (4 months to 11 years), and ST3: adolescence to adulthood (13 - 23 years)
The bar shown representes the lower 25% and upper 25% of the expression distribution.

No co-expressed genes in brain regions


Section III. Gene Ontology annotation

Molecular function 去的术语 Evidence Neuro keywords PubMed ID
GO:0000287 magnesium ion binding IEA -
GO:0016787 hydrolase activity IEA -

Section V. Pathway annotation

Pathway name Pathway size # SZGR 2.0 genes in pathway Info
CHANDRAN METASTASIS TOP50 DN 45 26 All SZGR 2.0 genes in this pathway
BASAKI YBX1 TARGETS DN 384 230 All SZGR 2.0 genes in this pathway
WANG LMO4 TARGETS UP 372 227 All SZGR 2.0 genes in this pathway
LINDGREN BLADDER CANCER CLUSTER 1 UP 121 71 All SZGR 2.0 genes in this pathway
MOTAMED RESPONSE TO ANDROGEN DN 6 5 All SZGR 2.0 genes in this pathway
HEIDENBLAD AMPLICON 8Q24 DN 46 28 All SZGR 2.0 genes in this pathway
BENPORATH CYCLING GENES 648 385 All SZGR 2.0 genes in this pathway
RIGGI EWING SARCOMA PROGENITOR UP 430 288 All SZGR 2.0 genes in this pathway
CHANDRAN METASTASIS DN 306 191 All SZGR 2.0 genes in this pathway
WHITFIELD CELL CYCLE S 162 86 All SZGR 2.0 genes in this pathway
PILON KLF1 TARGETS DN 1972 1213 All SZGR 2.0 genes in this pathway
JOHNSTONE PARVB TARGETS 3 UP 430 288 All SZGR 2.0 genes in this pathway
MIYAGAWA TARGETS OF EWSR1 ETS FUSIONS UP 259 159 All SZGR 2.0 genes in this pathway

Section VI. microRNA annotation

miRNA family Target position miRNA ID miRNA seq
UTR start UTR end Match method
miR-125/351 1423 1429 m8 hsa-miR-125bbrain UCCCUGAGACCCUAACUUGUGA
hsa-miR-125abrain UCCCUGAGACCCUUUAACCUGUG