Gene Page:C6orf136

Summary?
GeneID 221545
Symbol C6orf136
Synonyms -
Description chromosome 6 open reading frame 136
Reference HGNC:HGNC:21301|Ensembl:ENSG00000204564|HPRD:12851|Vega:OTTHUMG00000031221
Gene type protein-coding
Map location 6p21.33
Pascal p-value 2.809E-14
Sherlock p-value 0.511
Fetal beta -1.101
DMG 2 (# studies)
eGene Myers' cis & trans

Gene in Data Sources
Gene set name Method of gene set Description Info
CV:PGCnp Genome-wide Association Study GWAS
DMG:Montano_2016 Genome-wide DNA methylation analysis This dataset includes 172 replicated associations between CpGs with schizophrenia. 4
DMG:Wockner_2014 Genome-wide DNA methylation analysis This dataset includes 4641 differentially methylated probes corresponding to 2929 unique genes between schizophrenia patients (n=24) and controls (n=24). 4
GSMA_I Genome scan meta-analysis Psr: 0.033

Section I. Genetics and epigenetics annotation

@Differentially methylated gene

Probe Chromosome Position Nearest gene P (dis) Beta (dis) FDR (dis) Study
cg06996599 6 30619232 C6orf136 9.39E-7 0.007 0.015 DMG:Montano_2016
cg15045771 6 30616766 C6orf136 3.13E-5 0.305 0.019 DMG:Wockner_2014
cg13016528 6 30615944 C6orf136 8.94E-5 0.496 0.027 DMG:Wockner_2014
cg13583911 6 30614788 C6orf136 3.001E-4 -0.207 0.04 DMG:Wockner_2014

@eQTL annotation

SNP ID Chromosome Position eGene Gene Entrez ID pvalue qvalue TSS distance eQTL type
rs4854166 chr2 3297005 C6orf136 221545 0.07 trans

Section II. Transcriptome annotation

General gene expression (GTEx)

Not available

Gene expression during devlopment (BrainCloud)

Footnote:
A total of 269 time points ploted, with n=38 fetal samples (x=1:38). Each triangle represents one time point.

Gene expression of temporal and spatial changes (BrainSpan)

Footnote:
SC: sub-cortical regions; SM: sensory-motor regions; FC: frontal cortex; and TP: temporal-parietal cortex
ST1: fetal (13 - 26 postconception weeks), ST2: early infancy to late childhood (4 months to 11 years), and ST3: adolescence to adulthood (13 - 23 years)
The bar shown representes the lower 25% and upper 25% of the expression distribution.

No co-expressed genes in brain regions


Section V. Pathway annotation

Pathway name Pathway size # SZGR 2.0 genes in pathway Info
KINSEY TARGETS OF EWSR1 FLII FUSION UP 1278 748 All SZGR 2.0 genes in this pathway
GRAESSMANN APOPTOSIS BY DOXORUBICIN DN 1781 1082 All SZGR 2.0 genes in this pathway
GRAESSMANN RESPONSE TO MC AND DOXORUBICIN DN 770 415 All SZGR 2.0 genes in this pathway
BERENJENO通过RHOA转换 536 340 All SZGR 2.0 genes in this pathway
PATIL LIVER CANCER 747 453 All SZGR 2.0 genes in this pathway
BURTON ADIPOGENESIS 6 189 112 All SZGR 2.0 genes in this pathway
BILD E2F3 ONCOGENIC SIGNATURE 246 153 All SZGR 2.0 genes in this pathway
YAO TEMPORAL RESPONSE TO PROGESTERONE CLUSTER 14 143 86 All SZGR 2.0 genes in this pathway
CHICAS RB1 TARGETS SENESCENT 572 352 All SZGR 2.0 genes in this pathway
PILON KLF1 TARGETS DN 1972 1213 All SZGR 2.0 genes in this pathway

Section VI. microRNA annotation

miRNA family Target position miRNA ID miRNA seq
UTR start UTR end Match method
miR-148/152 24 30 1A hsa-miR-148a UCAGUGCACUACAGAACUUUGU
hsa-miR-152brain UCAGUGCAUGACAGAACUUGGG
hsa-miR-148b UCAGUGCAUCACAGAACUUUGU