Gene Page:SEMA3D

Summary?
GeneID 223117
Symbol SEMA3D
Synonyms Sema-Z2|coll-2
Description semaphorin 3D
Reference MIM:609907|HGNC:HGNC:10726|Ensembl:ENSG00000153993|HPRD:15321|Vega:OTTHUMG00000154569
Gene type protein-coding
Map location 7q21.11
Pascal p-value 0.056
Fetal beta -1.908

Gene in Data Sources
Gene set name Method of gene set Description Info
CV:PGCnp Genome-wide Association Study GWAS
PMID:cooccur High-throughput literature-search Systematic search in PubMed for genes co-occurring with SCZ keywords. A total of 3027 genes were included.
Literature High-throughput literature-search Co-occurance with Schizophrenia keywords: schizophrenia,schizophrenic,schizophrenias Click to show details
GO_Annotation Mapping neuro-related keywords to Gene Ontology annotations Hits with neuro-related keywords: 1

Section I. Genetics and epigenetics annotation


Section II. Transcriptome annotation

General gene expression (GTEx)

Not available

Gene expression during devlopment (BrainCloud)

Footnote:
A total of 269 time points ploted, with n=38 fetal samples (x=1:38). Each triangle represents one time point.

Gene expression of temporal and spatial changes (BrainSpan)

Footnote:
SC: sub-cortical regions; SM: sensory-motor regions; FC: frontal cortex; and TP: temporal-parietal cortex
ST1: fetal (13 - 26 postconception weeks), ST2: early infancy to late childhood (4 months to 11 years), and ST3: adolescence to adulthood (13 - 23 years)
The bar shown representes the lower 25% and upper 25% of the expression distribution.

No co-expressed genes in brain regions


Section III. Gene Ontology annotation

Molecular function GO term Evidence Neuro keywords PubMed ID
GO:0004872 receptor activity IEA -
Biological process GO term Evidence Neuro keywords PubMed ID
GO:0007399 nervous system development IEA neurite (GO term level: 5) -
GO:0007275 multicellular organismal development IEA -
GO:0030154 cell differentiation IEA -
Cellular component GO term Evidence Neuro keywords PubMed ID
GO:0005576 extracellular region IEA -
GO:0016020 membrane IEA -

Section V. Pathway annotation

Pathway name Pathway size # SZGR 2.0 genes in pathway Info
KEGG AXON GUIDANCE 129 103 All SZGR 2.0 genes in this pathway
DELYS THYROID CANCER DN 232 154 All SZGR 2.0 genes in this pathway
GAUSSMANN MLL AF4 FUSION TARGETS A DN 90 61 All SZGR 2.0 genes in this pathway
PUJANA BRCA1 PCC NETWORK 1652 1023 All SZGR 2.0 genes in this pathway
PUJANA ATM PCC NETWORK 1442 892 All SZGR 2.0 genes in this pathway
NUYTTEN NIPP1 TARGETS UP 769 437 All SZGR 2.0 genes in this pathway
NUYTTEN EZH2 TARGETS UP 1037 673 All SZGR 2.0 genes in this pathway
IVANOVA HEMATOPOIESIS STEM CELL 254 164 All SZGR 2.0 genes in this pathway
RAY TUMORIGENESIS BY ERBB2 CDC25A UP 104 57 All SZGR 2.0 genes in this pathway
MCMURRAY TP53 HRAS COOPERATION RESPONSE DN 67 46 All SZGR 2.0 genes in this pathway
CAIRO LIVER DEVELOPMENT UP 166 105 All SZGR 2.0 genes in this pathway
BROWNE HCMV INFECTION 1HR UP 61 44 All SZGR 2.0 genes in this pathway
BRUINS UVC RESPONSE VIA TP53 GROUP B 549 316 All SZGR 2.0 genes in this pathway
YANG BCL3 TARGETS UP 364 236 All SZGR 2.0 genes in this pathway
NABA ECM附属 171 89 All SZGR 2.0 genes in this pathway
NABA MATRISOME ASSOCIATED 753 411 All SZGR 2.0 genes in this pathway
NABA MATRISOME 1028 559 All SZGR 2.0 genes in this pathway

Section VI. microRNA annotation

miRNA family Target position miRNA ID miRNA seq
UTR start UTR end Match method
miR-15/16/195/424/497 2784 2791 1A,m8 hsa-miR-15abrain UAGCAGCACAUAAUGGUUUGUG
hsa-miR-16brain UAGCAGCACGUAAAUAUUGGCG
hsa-miR-15bbrain UAGCAGCACAUCAUGGUUUACA
hsa-miR-195SZ UAGCAGCACAGAAAUAUUGGC
hsa-miR-424 CAGCAGCAAUUCAUGUUUUGAA
hsa-miR-497 CAGCAGCACACUGUGGUUUGU
miR-342 1730 1736 1A hsa-miR-342brain UCUCACACAGAAAUCGCACCCGUC
miR-377 1624 1630 1A hsa-miR-377 AUCACACAAAGGCAACUUUUGU
miR-503 2785 2791 1A hsa-miR-503 UAGCAGCGGGAACAGUUCUGCAG