Gene Page:FGF12

Summary?
GeneID 2257
Symbol FGF12
Synonyms FGF12B|FHF1
Description fibroblast growth factor 12
Reference MIM:601513|HGNC:HGNC:3668|Ensembl:ENSG00000114279|HPRD:03303|Vega:OTTHUMG00000156132
Gene type protein-coding
Map location 3q28
Pascal p-value 0.005
Sherlock p-value 0.535
eGene Cerebellum

Gene in Data Sources
Gene set name Method of gene set Description Info
CV:PGCnp Genome-wide Association Study GWAS
GO_Annotation Mapping neuro-related keywords to Gene Ontology annotations Hits with neuro-related keywords: 1

Section I. Genetics and epigenetics annotation


Section II. Transcriptome annotation

General gene expression (GTEx)

Not available

Gene expression of temporal and spatial changes (BrainSpan)

Footnote:
SC: sub-cortical regions; SM: sensory-motor regions; FC: frontal cortex; and TP: temporal-parietal cortex
死神:胎儿(13 - 26 postconception周),ST2: early infancy to late childhood (4 months to 11 years), and ST3: adolescence to adulthood (13 - 23 years)
The bar shown representes the lower 25% and upper 25% of the expression distribution.

Top co-expressed genes in brain regions

Top 10 positively co-expressed genes
Gene Pearson's Correlation Spearman's Correlation
PPAP2A 0.80 0.81
ANGPTL6 0.80 0.84
BDH1 0.79 0.81
C5orf32 0.79 0.84
OMG 0.79 0.82
GNPTG 0.78 0.82
ANXA7 0.77 0.78
SHISA4 0.77 0.84
HHLA3 0.77 0.80
ACYP2 0.77 0.82
Top 10 negatively co-expressed genes
Gene Pearson's Correlation Spearman's Correlation
KIAA1949 -0.67 -0.60
ZNF300 -0.65 -0.56
ZNF551 -0.65 -0.58
TUBB2B -0.65 -0.62
AC004017.1 -0.65 -0.57
FNBP1L -0.63 -0.54
SETDB1 -0.63 -0.51
MYCN -0.63 -0.54
ZNF311 -0.63 -0.56
TIGD1 -0.63 -0.55

Section III. Gene Ontology annotation

Molecular function 去的术语 Evidence Neuro keywords PubMed ID
GO:0008083 growth factor activity IEA -
GO:0008083 growth factor activity TAS 8790420|10049777
Biological process 去的术语 Evidence Neuro keywords PubMed ID
GO:0007399 nervous system development TAS neurite (GO term level: 5) 8790420
GO:0007267 cell-cell signaling TAS 8790420|10049777
GO:0007165 signal transduction TAS 8790420|10049777
GO:0007507 heart development TAS 10049777
Cellular component 去的术语 Evidence Neuro keywords PubMed ID
GO:0005615 extracellular space TAS 10049777
GO:0005634 nucleus IDA 8790420

Section V. Pathway annotation

Pathway name Pathway size # SZGR 2.0 genes in pathway Info
KEGG MAPK SIGNALING PATHWAY 267 205 All SZGR 2.0 genes in this pathway
KEGG REGULATION OF ACTIN CYTOSKELETON 216 144 All SZGR 2.0 genes in this pathway
KEGG PATHWAYS IN CANCER 328 259 All SZGR 2.0 genes in this pathway
KEGG MELANOMA 71 57 All SZGR 2.0 genes in this pathway
BORCZUK MALIGNANT MESOTHELIOMA DN 104 59 All SZGR 2.0 genes in this pathway
MOHANKUMAR TLX1 TARGETS DN 193 112 All SZGR 2.0 genes in this pathway
JAZAG TGFB1 SIGNALING VIA SMAD4 UP 108 66 All SZGR 2.0 genes in this pathway
WANG RESPONSE TO BEXAROTENE DN 29 19 All SZGR 2.0 genes in this pathway
SCHAEFFER PROSTATE DEVELOPMENT 48HR UP 487 286 All SZGR 2.0 genes in this pathway
MORI SMALL PRE BII LYMPHOCYTE UP 86 57 All SZGR 2.0 genes in this pathway
LU AGING BRAIN DN 153 120 All SZGR 2.0 genes in this pathway
WANG SMARCE1 TARGETS DN 371 218 All SZGR 2.0 genes in this pathway
MCCLUNG CREB1 TARGETS UP 100 72 All SZGR 2.0 genes in this pathway
CREIGHTON ENDOCRINE THERAPY RESISTANCE 5 482 296 All SZGR 2.0 genes in this pathway
IWANAGA CARCINOGENESIS BY KRAS DN 120 81 All SZGR 2.0 genes in this pathway
RIZKI TUMOR INVASIVENESS 3D UP 210 124 All SZGR 2.0 genes in this pathway
GRADE COLON VS RECTAL CANCER DN 56 36 All SZGR 2.0 genes in this pathway
WEST ADRENOCORTICAL TUMOR DN 546 362 All SZGR 2.0 genes in this pathway
SHEDDEN LUNG CANCER GOOD SURVIVAL A12 317 177 All SZGR 2.0 genes in this pathway
MEISSNER NPC HCP WITH H3K4ME2 491 319 All SZGR 2.0 genes in this pathway
MIKKELSEN MCV6 HCP WITH H3K27ME3 435 318 All SZGR 2.0 genes in this pathway
MIKKELSEN IPS WITH HCP H3K27ME3 102 76 All SZGR 2.0 genes in this pathway
MIKKELSEN MEF HCP WITH H3K27ME3 590 403 All SZGR 2.0 genes in this pathway
PURBEY TARGETS OF CTBP1 AND SATB1 DN 180 116 All SZGR 2.0 genes in this pathway
KRIEG HYPOXIA NOT VIA KDM3A 770 480 All SZGR 2.0 genes in this pathway
PEDRIOLI MIR31 TARGETS DN 418 245 All SZGR 2.0 genes in this pathway
NABA SECRETED FACTORS 344 197 All SZGR 2.0 genes in this pathway
NABA MATRISOME ASSOCIATED 753 411 All SZGR 2.0 genes in this pathway
NABA MATRISOME 1028 559 All SZGR 2.0 genes in this pathway

Section VI. microRNA annotation

miRNA family Target position miRNA ID miRNA seq
UTR start UTR end Match method
miR-384 1965 1972 1A,m8 hsa-miR-384 AUUCCUAGAAAUUGUUCAUA
miR-544 1650 1656 m8 hsa-miR-544 AUUCUGCAUUUUUAGCAAGU
miR-9 174 180 m8 hsa-miR-9SZ UCUUUGGUUAUCUAGCUGUAUGA