Gene Page:SORCS3

Summary?
GeneID 22986
Symbol SORCS3
Synonyms SORCS
Description sortilin related VPS10 domain containing receptor 3
Reference MIM:606285|HGNC:HGNC:16699|Ensembl:ENSG00000156395|HPRD:12100|Vega:OTTHUMG00000019011
Gene type protein-coding
Map location 10q23-q25
Pascal p-value 1.925E-5
Sherlock p-value 0.096
eGene Myers' cis & trans

Gene in Data Sources
Gene set name Method of gene set Description Info
CV:PGCnp Genome-wide Association Study GWAS
GO_Annotation Mapping neuro-related keywords to Gene Ontology annotations Hits with neuro-related keywords: 2

Section I. Genetics and epigenetics annotation

@eQTL annotation

SNP ID Chromosome Position eGene Gene Entrez ID pvalue qvalue TSS distance eQTL type
rs12063095 chr1 85975456 SORCS3 22986 0.15 trans
rs16866571 chr2 8161537 SORCS3 22986 0.02 trans
rs9311908 chr3 64702173 SORCS3 22986 0.06 trans
rs10516815 chr4 89587324 SORCS3 22986 0.06 trans
rs2860259 chr4 89587833 SORCS3 22986 0.14 trans
rs848400 chr7 108525043 SORCS3 22986 0.03 trans
rs2253255 chr8 97522542 SORCS3 22986 0.15 trans
rs10501658 chr11 87788891 SORCS3 22986 0.05 trans
snp_a-4223854 0 SORCS3 22986 0.08 trans
rs16978564 chr18 44037097 SORCS3 22986 4.454E-4 trans
rs11796450 chrX 3983128 SORCS3 22986 0 trans
rs16978802 chrX 3998040 SORCS3 22986 0 trans

Section II. Transcriptome annotation

General gene expression (GTEx)

Not available

Gene expression of temporal and spatial changes (BrainSpan)

Footnote:
SC: sub-cortical regions; SM: sensory-motor regions; FC: frontal cortex; and TP: temporal-parietal cortex
ST1: fetal (13 - 26 postconception weeks), ST2: early infancy to late childhood (4 months to 11 years), and ST3: adolescence to adulthood (13 - 23 years)
The bar shown representes the lower 25% and upper 25% of the expression distribution.

Top co-expressed genes in brain regions

Top 10 positively co-expressed genes
Gene Pearson's Correlation Spearman's Correlation
TRIM24 0.91 0.91
CHST10 0.90 0.90
ZNF480 0.89 0.84
EML4 0.88 0.91
C20orf74 0.88 0.90
KDM5B 0.88 0.91
ATF7IP 0.88 0.90
NONO 0.88 0.90
ALDH18A1 0.88 0.90
PRRC1 0.88 0.89
Top 10 negatively co-expressed genes
Gene Pearson's Correlation Spearman's Correlation
C5orf53 -0.66 -0.76
HLA-F -0.64 -0.75
AF347015.27 -0.63 -0.85
FXYD1 -0.63 -0.84
S100B -0.62 -0.79
AF347015.31 -0.62 -0.83
TSC22D4 -0.62 -0.76
MT-CO2 -0.62 -0.85
AF347015.33 -0.62 -0.82
SLC16A11 -0.62 -0.65

Section III. Gene Ontology annotation

Molecular function 去的术语 Evidence Neuro keywords PubMed ID
GO:0008188 neuropeptide receptor activity NAS Neurotransmitter (GO term level: 8) 11499680
Biological process 去的术语 Evidence Neuro keywords PubMed ID
GO:0007218 neuropeptide signaling pathway NAS Neurotransmitter (GO term level: 8) 11499680
Cellular component 去的术语 Evidence Neuro keywords PubMed ID
GO:0016020 membrane NAS 11499680
GO:0016021 integral to membrane IEA -

Section V. Pathway annotation

Pathway name Pathway size # SZGR 2.0 genes in pathway Info
REACTOME SIGNALLING BY NGF 217 167 All SZGR 2.0 genes in this pathway
REACTOME P75 NTR RECEPTOR MEDIATED SIGNALLING 81 61 All SZGR 2.0 genes in this pathway
DN CHEBOTAEV GR目标 120 73 All SZGR 2.0 genes in this pathway
BENPORATH SUZ12 TARGETS 1038 678 All SZGR 2.0 genes in this pathway
BENPORATH EED TARGETS 1062 725 All SZGR 2.0 genes in this pathway
BENPORATH ES WITH H3K27ME3 1118 744 All SZGR 2.0 genes in this pathway
BENPORATH PRC2 TARGETS 652 441 All SZGR 2.0 genes in this pathway
BLALOCK ALZHEIMERS DISEASE DN 1237 837 All SZGR 2.0 genes in this pathway
BROWNE HCMV INFECTION 18HR UP 178 111 All SZGR 2.0 genes in this pathway
阿塞维多甲基化IN LIVER CANCER DN 940 425 All SZGR 2.0 genes in this pathway
LIN NPAS4 TARGETS DN 68 48 All SZGR 2.0 genes in this pathway
MEISSNER NPC HCP WITH H3K4ME2 AND H3K27ME3 349 234 All SZGR 2.0 genes in this pathway
MIKKELSEN IPS WITH HCP H3K27ME3 102 76 All SZGR 2.0 genes in this pathway
MIKKELSEN NPC HCP WITH H3K27ME3 341 243 All SZGR 2.0 genes in this pathway
MIKKELSEN MEF HCP WITH H3K27ME3 590 403 All SZGR 2.0 genes in this pathway
VERHAAK GLIOBLASTOMA PRONEURAL 177 132 All SZGR 2.0 genes in this pathway
ZWANG TRANSIENTLY UP BY 2ND EGF PULSE ONLY 1725 838 All SZGR 2.0 genes in this pathway

Section VI. microRNA annotation

miRNA family Target position miRNA ID miRNA seq
UTR start UTR end Match method
miR-101 1802 1808 1A hsa-miR-101 UACAGUACUGUGAUAACUGAAG
miR-144 1764 1770 m8 hsa-miR-144 UACAGUAUAGAUGAUGUACUAG
hsa-miR-144 UACAGUAUAGAUGAUGUACUAG
miR-30-5p 100 106 m8 hsa-miR-30a-5p UGUAAACAUCCUCGACUGGAAG
hsa-miR-30cbrain UGUAAACAUCCUACACUCUCAGC
hsa-miR-30dSZ UGUAAACAUCCCCGACUGGAAG
hsa-miR-30bSZ UGUAAACAUCCUACACUCAGCU
hsa-miR-30e-5p UGUAAACAUCCUUGACUGGA
miR-342 1578 1584 1A hsa-miR-342brain UCUCACACAGAAAUCGCACCCGUC
miR-346 1685 1692 1A,m8 hsa-miR-346brain UGUCUGCCCGCAUGCCUGCCUCU
miR-382 1284 1290 m8 hsa-miR-382brain GAAGUUGUUCGUGGUGGAUUCG
miR-493-5p 1756 1762 m8 hsa-miR-493-5p UUGUACAUGGUAGGCUUUCAUU
hsa-miR-493-5p UUGUACAUGGUAGGCUUUCAUU
miR-496 544 550 1A hsa-miR-496 AUUACAUGGCCAAUCUC
miR-505 1833 1839 1A hsa-miR-505 GUCAACACUUGCUGGUUUCCUC