Gene Page:SORCS3
Summary?
GeneID | 22986 |
Symbol | SORCS3 |
Synonyms | SORCS |
Description | sortilin related VPS10 domain containing receptor 3 |
Reference | MIM:606285|HGNC:HGNC:16699|Ensembl:ENSG00000156395|HPRD:12100|Vega:OTTHUMG00000019011 |
Gene type | protein-coding |
Map location | 10q23-q25 |
Pascal p-value | 1.925E-5 |
Sherlock p-value | 0.096 |
eGene | Myers' cis & trans |
Gene in Data Sources
Gene set name | Method of gene set | Description | Info |
---|---|---|---|
CV:PGCnp | Genome-wide Association Study | GWAS | |
GO_Annotation | Mapping neuro-related keywords to Gene Ontology annotations | Hits with neuro-related keywords: 2 |
Section I. Genetics and epigenetics annotation
eQTL annotation
SNP ID | Chromosome | Position | eGene | Gene Entrez ID | pvalue | qvalue | TSS distance | eQTL type |
---|---|---|---|---|---|---|---|---|
rs12063095 | chr1 | 85975456 | SORCS3 | 22986 | 0.15 | trans | ||
rs16866571 | chr2 | 8161537 | SORCS3 | 22986 | 0.02 | trans | ||
rs9311908 | chr3 | 64702173 | SORCS3 | 22986 | 0.06 | trans | ||
rs10516815 | chr4 | 89587324 | SORCS3 | 22986 | 0.06 | trans | ||
rs2860259 | chr4 | 89587833 | SORCS3 | 22986 | 0.14 | trans | ||
rs848400 | chr7 | 108525043 | SORCS3 | 22986 | 0.03 | trans | ||
rs2253255 | chr8 | 97522542 | SORCS3 | 22986 | 0.15 | trans | ||
rs10501658 | chr11 | 87788891 | SORCS3 | 22986 | 0.05 | trans | ||
snp_a-4223854 | 0 | SORCS3 | 22986 | 0.08 | trans | |||
rs16978564 | chr18 | 44037097 | SORCS3 | 22986 | 4.454E-4 | trans | ||
rs11796450 | chrX | 3983128 | SORCS3 | 22986 | 0 | trans | ||
rs16978802 | chrX | 3998040 | SORCS3 | 22986 | 0 | trans |
Section II. Transcriptome annotation
General gene expression (GTEx)
![Not available](http://www.tjghsg.com/bioinfo/SZGR/GeneImg/SORCS3_DE_GTEx.png)
Gene expression of temporal and spatial changes (BrainSpan)
Footnote:
SC: sub-cortical regions; SM: sensory-motor regions; FC: frontal cortex; and TP: temporal-parietal cortex
ST1: fetal (13 - 26 postconception weeks), ST2: early infancy to late childhood (4 months to 11 years), and ST3: adolescence to adulthood (13 - 23 years)
The bar shown representes the lower 25% and upper 25% of the expression distribution.
Top co-expressed genes in brain regions
Top 10 positively co-expressed genes | ||
Gene | Pearson's Correlation | Spearman's Correlation |
TRIM24 | 0.91 | 0.91 |
CHST10 | 0.90 | 0.90 |
ZNF480 | 0.89 | 0.84 |
EML4 | 0.88 | 0.91 |
C20orf74 | 0.88 | 0.90 |
KDM5B | 0.88 | 0.91 |
ATF7IP | 0.88 | 0.90 |
NONO | 0.88 | 0.90 |
ALDH18A1 | 0.88 | 0.90 |
PRRC1 | 0.88 | 0.89 |
Top 10 negatively co-expressed genes | ||
Gene | Pearson's Correlation | Spearman's Correlation |
C5orf53 | -0.66 | -0.76 |
HLA-F | -0.64 | -0.75 |
AF347015.27 | -0.63 | -0.85 |
FXYD1 | -0.63 | -0.84 |
S100B | -0.62 | -0.79 |
AF347015.31 | -0.62 | -0.83 |
TSC22D4 | -0.62 | -0.76 |
MT-CO2 | -0.62 | -0.85 |
AF347015.33 | -0.62 | -0.82 |
SLC16A11 | -0.62 | -0.65 |
Section III. Gene Ontology annotation
Molecular function | 去的术语 | Evidence | Neuro keywords | PubMed ID |
---|---|---|---|---|
GO:0008188 | neuropeptide receptor activity | NAS | Neurotransmitter (GO term level: 8) | 11499680 |
Biological process | 去的术语 | Evidence | Neuro keywords | PubMed ID |
GO:0007218 | neuropeptide signaling pathway | NAS | Neurotransmitter (GO term level: 8) | 11499680 |
Cellular component | 去的术语 | Evidence | Neuro keywords | PubMed ID |
GO:0016020 | membrane | NAS | 11499680 | |
GO:0016021 | integral to membrane | IEA | - |
Section V. Pathway annotation
Pathway name | Pathway size | # SZGR 2.0 genes in pathway | Info |
---|---|---|---|
REACTOME SIGNALLING BY NGF | 217 | 167 | All SZGR 2.0 genes in this pathway |
REACTOME P75 NTR RECEPTOR MEDIATED SIGNALLING | 81 | 61 | All SZGR 2.0 genes in this pathway |
DN CHEBOTAEV GR目标 | 120 | 73 | All SZGR 2.0 genes in this pathway |
BENPORATH SUZ12 TARGETS | 1038 | 678 | All SZGR 2.0 genes in this pathway |
BENPORATH EED TARGETS | 1062 | 725 | All SZGR 2.0 genes in this pathway |
BENPORATH ES WITH H3K27ME3 | 1118 | 744 | All SZGR 2.0 genes in this pathway |
BENPORATH PRC2 TARGETS | 652 | 441 | All SZGR 2.0 genes in this pathway |
BLALOCK ALZHEIMERS DISEASE DN | 1237 | 837 | All SZGR 2.0 genes in this pathway |
BROWNE HCMV INFECTION 18HR UP | 178 | 111 | All SZGR 2.0 genes in this pathway |
阿塞维多甲基化IN LIVER CANCER DN | 940 | 425 | All SZGR 2.0 genes in this pathway |
LIN NPAS4 TARGETS DN | 68 | 48 | All SZGR 2.0 genes in this pathway |
MEISSNER NPC HCP WITH H3K4ME2 AND H3K27ME3 | 349 | 234 | All SZGR 2.0 genes in this pathway |
MIKKELSEN IPS WITH HCP H3K27ME3 | 102 | 76 | All SZGR 2.0 genes in this pathway |
MIKKELSEN NPC HCP WITH H3K27ME3 | 341 | 243 | All SZGR 2.0 genes in this pathway |
MIKKELSEN MEF HCP WITH H3K27ME3 | 590 | 403 | All SZGR 2.0 genes in this pathway |
VERHAAK GLIOBLASTOMA PRONEURAL | 177 | 132 | All SZGR 2.0 genes in this pathway |
ZWANG TRANSIENTLY UP BY 2ND EGF PULSE ONLY | 1725 | 838 | All SZGR 2.0 genes in this pathway |
Section VI. microRNA annotation
miRNA family | Target position | miRNA ID | miRNA seq | ||
---|---|---|---|---|---|
UTR start | UTR end | Match method | |||
miR-101 | 1802 | 1808 | 1A | hsa-miR-101 | UACAGUACUGUGAUAACUGAAG |
miR-144 | 1764 | 1770 | m8 | hsa-miR-144 | UACAGUAUAGAUGAUGUACUAG |
hsa-miR-144 | UACAGUAUAGAUGAUGUACUAG | ||||
miR-30-5p | 100 | 106 | m8 | hsa-miR-30a-5p | UGUAAACAUCCUCGACUGGAAG |
hsa-miR-30cbrain | UGUAAACAUCCUACACUCUCAGC | ||||
hsa-miR-30dSZ | UGUAAACAUCCCCGACUGGAAG | ||||
hsa-miR-30bSZ | UGUAAACAUCCUACACUCAGCU | ||||
hsa-miR-30e-5p | UGUAAACAUCCUUGACUGGA | ||||
miR-342 | 1578 | 1584 | 1A | hsa-miR-342brain | UCUCACACAGAAAUCGCACCCGUC |
miR-346 | 1685 | 1692 | 1A,m8 | hsa-miR-346brain | UGUCUGCCCGCAUGCCUGCCUCU |
miR-382 | 1284 | 1290 | m8 | hsa-miR-382brain | GAAGUUGUUCGUGGUGGAUUCG |
miR-493-5p | 1756 | 1762 | m8 | hsa-miR-493-5p | UUGUACAUGGUAGGCUUUCAUU |
hsa-miR-493-5p | UUGUACAUGGUAGGCUUUCAUU | ||||
miR-496 | 544 | 550 | 1A | hsa-miR-496 | AUUACAUGGCCAAUCUC |
miR-505 | 1833 | 1839 | 1A | hsa-miR-505 | GUCAACACUUGCUGGUUUCCUC |
- SZ: miRNAs which differentially expressed in brain cortex of schizophrenia patients comparing with control samples using microarray. Clickhereto see the list of SZ related miRNAs.
- Brain: miRNAs which are expressed in brain based on miRNA microarray expression studies. Clickhereto see the list of brain related miRNAs.