Gene Page:XPO7

Summary?
GeneID 23039
Symbol XPO7
Synonyms EXP7|RANBP16
Description exportin 7
Reference MIM:606140|HGNC:HGNC:14108|Ensembl:ENSG00000130227|HPRD:05846|Vega:OTTHUMG00000163789
Gene type protein-coding
Map location 8p21
Pascal p-value 0.996
Sherlock p-value 0.032
TADA p-value 0.017
Fetal beta 0.927
DMG 1 (# studies)
Support CompositeSet
Darnell FMRP targets

Gene in Data Sources
Gene set name Method of gene set Description Info
CV:PGCnp Genome-wide Association Study GWAS
DMG:Jaffe_2016 Genome-wide DNA methylation analysis This dataset includes 2,104 probes/CpGs associated with SZ patients (n=108) compared to 136 controls at Bonferroni-adjusted P < 0.05. 1
DNM:Fromer_2014 Whole Exome Sequencing analysis This study reported a WES study of 623 schizophrenia trios, reporting DNMs using genomic DNA.
GSMA_I Genome scan meta-analysis Psr: 0.031
GSMA_IIA Genome scan meta-analysis (All samples) Psr: 0.03086
GSMA_IIE Genome scan meta-analysis (European-ancestry samples) Psr: 0.00057

Section I. Genetics and epigenetics annotation

@DNM table

Gene Chromosome Position Ref Alt Transcript AA change Mutation type Sift CG46 Trait Study
XPO7 chr8 21849382 A G NM_015024
NM_015024		 .
p.682E>G		 splice
missense		 Schizophrenia DNM:Fromer_2014

@Differentially methylated gene

Probe Chromosome Position Nearest gene P (dis) Beta (dis) FDR (dis) Study
cg19201477 8 21776851 XPO7 3.13E-8 -0.013 9.5E-6 DMG:Jaffe_2016


Section II. Transcriptome annotation

General gene expression (GTEx)

Not available

Gene expression during devlopment (BrainCloud)

Footnote:
A total of 269 time points ploted, with n=38 fetal samples (x=1:38). Each triangle represents one time point.

Gene expression of temporal and spatial changes (BrainSpan)

Footnote:
SC: sub-cortical regions; SM: sensory-motor regions; FC: frontal cortex; and TP: temporal-parietal cortex
死神:胎儿(13 - 26 postconceptionweeks), ST2: early infancy to late childhood (4 months to 11 years), and ST3: adolescence to adulthood (13 - 23 years)
The bar shown representes the lower 25% and upper 25% of the expression distribution.

Top co-expressed genes in brain regions

Top 10 positively co-expressed genes
Gene Pearson's Correlation Spearman's Correlation
SCN3A 0.91 0.92
NAV3 0.90 0.92
SOS1 0.90 0.93
ACACA 0.90 0.92
MAP3K7IP3 0.90 0.93
USP34 0.89 0.93
B4GALT5 0.89 0.91
C5orf42 0.88 0.91
KCTD10 0.88 0.92
MGEA5 0.88 0.93
Top 10 negatively co-expressed genes
Gene Pearson's Correlation Spearman's Correlation
MT-CO2 -0.70 -0.81
AF347015.31 -0.70 -0.79
FXYD1 -0.69 -0.77
IFI27 -0.68 -0.77
HIGD1B -0.68 -0.81
S100B -0.67 -0.74
AF347015.33 -0.66 -0.73
AC021016.1 -0.66 -0.76
HSD17B14 -0.66 -0.72
AF347015.27 -0.66 -0.74

Section III. Gene Ontology annotation

Molecular function 去的术语 Evidence Neuro keywords PubMed ID
GO:0005049 nuclear export signal receptor activity IDA 11024021
GO:0005488 binding IEA -
GO:0008565 protein transporter activity IEA -
Biological process 去的术语 Evidence Neuro keywords PubMed ID
GO:0000059 protein import into nucleus, docking IEA -
GO:0006611 protein export from nucleus IDA 11024021
GO:0006886 intracellular protein transport IEA -
GO:0051028 mRNA transport IEA -
GO:0065002 intracellular protein transmembrane transport IEA -
Cellular component 去的术语 Evidence Neuro keywords PubMed ID
GO:0005634 nucleus IDA 11071879
GO:0005634 nucleus IEA -
GO:0005643 nuclear pore IDA 11024021
GO:0005643 nuclear pore IEA -
GO:0005737 cytoplasm IDA 11071879
GO:0005737 cytoplasm IEA -

Section V. Pathway annotation

Pathway name Pathway size # SZGR 2.0 genes in pathway Info
HOLLMANN APOPTOSIS VIA CD40 UP 201 125 All SZGR 2.0 genes in this pathway
THUM SYSTOLIC HEART FAILURE UP 423 283 All SZGR 2.0 genes in this pathway
KINSEY TARGETS OF EWSR1 FLII FUSION UP 1278 748 All SZGR 2.0 genes in this pathway
RODRIGUES THYROID CARCINOMA POORLY DIFFERENTIATED DN 805 505 All SZGR 2.0 genes in this pathway
GRAESSMANN APOPTOSIS BY DOXORUBICIN DN 1781 1082 All SZGR 2.0 genes in this pathway
GAUSSMANN MLL AF4 FUSION TARGETS D UP 38 23 All SZGR 2.0 genes in this pathway
PATIL LIVER CANCER 747 453 All SZGR 2.0 genes in this pathway
LOPEZ MBD TARGETS 957 597 All SZGR 2.0 genes in this pathway
BYSTRYKH HEMATOPOIESIS STEM CELL QTL TRANS 882 572 All SZGR 2.0 genes in this pathway
JAIN NFKB SIGNALING 75 44 All SZGR 2.0 genes in this pathway
ABE VEGFA TARGETS 2HR 34 21 All SZGR 2.0 genes in this pathway
IVANOVA HEMATOPOIESIS MATURE CELL 293 160 All SZGR 2.0 genes in this pathway
BLALOCK ALZHEIMERS DISEASE DN 1237 837 All SZGR 2.0 genes in this pathway
MARSON BOUND BY FOXP3 UNSTIMULATED 1229 713 All SZGR 2.0 genes in this pathway
HAN SATB1 TARGETS UP 395 249 All SZGR 2.0 genes in this pathway
YAMASHITA LIVER CANCER WITH EPCAM UP 53 25 All SZGR 2.0 genes in this pathway
CAIRO HEPATOBLASTOMA CLASSES UP 605 377 All SZGR 2.0 genes in this pathway
KIM BIPOLAR DISORDER OLIGODENDROCYTE DENSITY CORR UP 682 440 All SZGR 2.0 genes in this pathway
KIM ALL DISORDERS CALB1 CORR UP 548 370 All SZGR 2.0 genes in this pathway
PILON KLF1 TARGETS DN 1972 1213 All SZGR 2.0 genes in this pathway
BAKKER FOXO3 TARGETS UP 61 41 All SZGR 2.0 genes in this pathway

Section VI. microRNA annotation

miRNA family Target position miRNA ID miRNA seq
UTR start UTR end Match method
miR-331 104 110 m8 hsa-miR-331brain GCCCCUGGGCCUAUCCUAGAA
miR-381 318 325 1A,m8 hsa-miR-381 UAUACAAGGGCAAGCUCUCUGU
miR-493-5p 329 335 m8 hsa-miR-493-5p UUGUACAUGGUAGGCUUUCAUU