Gene Page:XPO7
Summary?
GeneID | 23039 |
Symbol | XPO7 |
Synonyms | EXP7|RANBP16 |
Description | exportin 7 |
Reference | MIM:606140|HGNC:HGNC:14108|Ensembl:ENSG00000130227|HPRD:05846|Vega:OTTHUMG00000163789 |
Gene type | protein-coding |
Map location | 8p21 |
Pascal p-value | 0.996 |
Sherlock p-value | 0.032 |
TADA p-value | 0.017 |
Fetal beta | 0.927 |
DMG | 1 (# studies) |
Support | CompositeSet Darnell FMRP targets |
Gene in Data Sources
Gene set name | Method of gene set | Description | Info |
---|---|---|---|
CV:PGCnp | Genome-wide Association Study | GWAS | |
DMG:Jaffe_2016 | Genome-wide DNA methylation analysis | This dataset includes 2,104 probes/CpGs associated with SZ patients (n=108) compared to 136 controls at Bonferroni-adjusted P < 0.05. | 1 |
DNM:Fromer_2014 | Whole Exome Sequencing analysis | This study reported a WES study of 623 schizophrenia trios, reporting DNMs using genomic DNA. | |
GSMA_I | Genome scan meta-analysis | Psr: 0.031 | |
GSMA_IIA | Genome scan meta-analysis (All samples) | Psr: 0.03086 | |
GSMA_IIE | Genome scan meta-analysis (European-ancestry samples) | Psr: 0.00057 |
Section I. Genetics and epigenetics annotation
DNM table
Gene | Chromosome | Position | Ref | Alt | Transcript | AA change | Mutation type | Sift | CG46 | Trait | Study |
---|---|---|---|---|---|---|---|---|---|---|---|
XPO7 | chr8 | 21849382 | A | G | NM_015024 NM_015024 |
. p.682E>G |
splice missense |
Schizophrenia | DNM:Fromer_2014 |
Differentially methylated gene
Probe | Chromosome | Position | Nearest gene | P (dis) | Beta (dis) | FDR (dis) | Study |
---|---|---|---|---|---|---|---|
cg19201477 | 8 | 21776851 | XPO7 | 3.13E-8 | -0.013 | 9.5E-6 | DMG:Jaffe_2016 |
Section II. Transcriptome annotation
General gene expression (GTEx)
![Not available](http://www.tjghsg.com/bioinfo/SZGR/GeneImg/XPO7_DE_GTEx.png)
Gene expression during devlopment (BrainCloud)
Footnote:
A total of 269 time points ploted, with n=38 fetal samples (x=1:38). Each triangle represents one time point.
Gene expression of temporal and spatial changes (BrainSpan)
Footnote:
SC: sub-cortical regions; SM: sensory-motor regions; FC: frontal cortex; and TP: temporal-parietal cortex
死神:胎儿(13 - 26 postconceptionweeks), ST2: early infancy to late childhood (4 months to 11 years), and ST3: adolescence to adulthood (13 - 23 years)
The bar shown representes the lower 25% and upper 25% of the expression distribution.
Top co-expressed genes in brain regions
Top 10 positively co-expressed genes | ||
Gene | Pearson's Correlation | Spearman's Correlation |
SCN3A | 0.91 | 0.92 |
NAV3 | 0.90 | 0.92 |
SOS1 | 0.90 | 0.93 |
ACACA | 0.90 | 0.92 |
MAP3K7IP3 | 0.90 | 0.93 |
USP34 | 0.89 | 0.93 |
B4GALT5 | 0.89 | 0.91 |
C5orf42 | 0.88 | 0.91 |
KCTD10 | 0.88 | 0.92 |
MGEA5 | 0.88 | 0.93 |
Top 10 negatively co-expressed genes | ||
Gene | Pearson's Correlation | Spearman's Correlation |
MT-CO2 | -0.70 | -0.81 |
AF347015.31 | -0.70 | -0.79 |
FXYD1 | -0.69 | -0.77 |
IFI27 | -0.68 | -0.77 |
HIGD1B | -0.68 | -0.81 |
S100B | -0.67 | -0.74 |
AF347015.33 | -0.66 | -0.73 |
AC021016.1 | -0.66 | -0.76 |
HSD17B14 | -0.66 | -0.72 |
AF347015.27 | -0.66 | -0.74 |
Section III. Gene Ontology annotation
Molecular function | 去的术语 | Evidence | Neuro keywords | PubMed ID |
---|---|---|---|---|
GO:0005049 | nuclear export signal receptor activity | IDA | 11024021 | |
GO:0005488 | binding | IEA | - | |
GO:0008565 | protein transporter activity | IEA | - | |
Biological process | 去的术语 | Evidence | Neuro keywords | PubMed ID |
GO:0000059 | protein import into nucleus, docking | IEA | - | |
GO:0006611 | protein export from nucleus | IDA | 11024021 | |
GO:0006886 | intracellular protein transport | IEA | - | |
GO:0051028 | mRNA transport | IEA | - | |
GO:0065002 | intracellular protein transmembrane transport | IEA | - | |
Cellular component | 去的术语 | Evidence | Neuro keywords | PubMed ID |
GO:0005634 | nucleus | IDA | 11071879 | |
GO:0005634 | nucleus | IEA | - | |
GO:0005643 | nuclear pore | IDA | 11024021 | |
GO:0005643 | nuclear pore | IEA | - | |
GO:0005737 | cytoplasm | IDA | 11071879 | |
GO:0005737 | cytoplasm | IEA | - |
Section V. Pathway annotation
Pathway name | Pathway size | # SZGR 2.0 genes in pathway | Info |
---|---|---|---|
HOLLMANN APOPTOSIS VIA CD40 UP | 201 | 125 | All SZGR 2.0 genes in this pathway |
THUM SYSTOLIC HEART FAILURE UP | 423 | 283 | All SZGR 2.0 genes in this pathway |
KINSEY TARGETS OF EWSR1 FLII FUSION UP | 1278 | 748 | All SZGR 2.0 genes in this pathway |
RODRIGUES THYROID CARCINOMA POORLY DIFFERENTIATED DN | 805 | 505 | All SZGR 2.0 genes in this pathway |
GRAESSMANN APOPTOSIS BY DOXORUBICIN DN | 1781 | 1082 | All SZGR 2.0 genes in this pathway |
GAUSSMANN MLL AF4 FUSION TARGETS D UP | 38 | 23 | All SZGR 2.0 genes in this pathway |
PATIL LIVER CANCER | 747 | 453 | All SZGR 2.0 genes in this pathway |
LOPEZ MBD TARGETS | 957 | 597 | All SZGR 2.0 genes in this pathway |
BYSTRYKH HEMATOPOIESIS STEM CELL QTL TRANS | 882 | 572 | All SZGR 2.0 genes in this pathway |
JAIN NFKB SIGNALING | 75 | 44 | All SZGR 2.0 genes in this pathway |
ABE VEGFA TARGETS 2HR | 34 | 21 | All SZGR 2.0 genes in this pathway |
IVANOVA HEMATOPOIESIS MATURE CELL | 293 | 160 | All SZGR 2.0 genes in this pathway |
BLALOCK ALZHEIMERS DISEASE DN | 1237 | 837 | All SZGR 2.0 genes in this pathway |
MARSON BOUND BY FOXP3 UNSTIMULATED | 1229 | 713 | All SZGR 2.0 genes in this pathway |
HAN SATB1 TARGETS UP | 395 | 249 | All SZGR 2.0 genes in this pathway |
YAMASHITA LIVER CANCER WITH EPCAM UP | 53 | 25 | All SZGR 2.0 genes in this pathway |
CAIRO HEPATOBLASTOMA CLASSES UP | 605 | 377 | All SZGR 2.0 genes in this pathway |
KIM BIPOLAR DISORDER OLIGODENDROCYTE DENSITY CORR UP | 682 | 440 | All SZGR 2.0 genes in this pathway |
KIM ALL DISORDERS CALB1 CORR UP | 548 | 370 | All SZGR 2.0 genes in this pathway |
PILON KLF1 TARGETS DN | 1972 | 1213 | All SZGR 2.0 genes in this pathway |
BAKKER FOXO3 TARGETS UP | 61 | 41 | All SZGR 2.0 genes in this pathway |
Section VI. microRNA annotation
miRNA family | Target position | miRNA ID | miRNA seq | ||
---|---|---|---|---|---|
UTR start | UTR end | Match method | |||
miR-331 | 104 | 110 | m8 | hsa-miR-331brain | GCCCCUGGGCCUAUCCUAGAA |
miR-381 | 318 | 325 | 1A,m8 | hsa-miR-381 | UAUACAAGGGCAAGCUCUCUGU |
miR-493-5p | 329 | 335 | m8 | hsa-miR-493-5p | UUGUACAUGGUAGGCUUUCAUU |
- SZ: miRNAs which differentially expressed in brain cortex of schizophrenia patients comparing with control samples using microarray. Clickhereto see the list of SZ related miRNAs.
- Brain: miRNAs which are expressed in brain based on miRNA microarray expression studies. Clickhereto see the list of brain related miRNAs.