Gene Page:ZNF423

Summary?
GeneID 23090
Symbol ZNF423
Synonyms Ebfaz|JBTS19|NPHP14|OAZ|Roaz|ZFP423|Zfp104|hOAZ
Description zinc finger protein 423
Reference MIM:604557|HGNC:HGNC:16762|Ensembl:ENSG00000102935|HPRD:05189|Vega:OTTHUMG00000173491
Gene type protein-coding
Map location 16q12
Pascal p-value 0.026
Fetal beta 1.797
DMG 1 (# studies)

Gene in Data Sources
Gene set name Method of gene set Description Info
简历:GWASdb Genome-wide Association Studies GWASdb records for schizophrenia
CV:PGCnp Genome-wide Association Study GWAS
DMG:Wockner_2014 Genome-wide DNA methylation analysis This dataset includes 4641 differentially methylated probes corresponding to 2929 unique genes between schizophrenia patients (n=24) and controls (n=24). 1
GSMA_IIE Genome scan meta-analysis (European-ancestry samples) Psr: 0.01775
GO_Annotation Mapping neuro-related keywords to Gene Ontology annotations Hits with neuro-related keywords: 1

Section I. Genetics and epigenetics annotation

@Differentially methylated gene

Probe Chromosome Position Nearest gene P (dis) Beta (dis) FDR (dis) Study
cg27360784 16 49525304 ZNF423 5.786E-4 0.297 0.049 DMG:Wockner_2014


Section II. Transcriptome annotation

General gene expression (GTEx)

Not available

Gene expression during devlopment (BrainCloud)

Footnote:
A total of 269 time points ploted, with n=38 fetal samples (x=1:38). Each triangle represents one time point.

Gene expression of temporal and spatial changes (BrainSpan)

Footnote:
SC: sub-cortical regions; SM: sensory-motor regions; FC: frontal cortex; and TP: temporal-parietal cortex
死神:胎儿(13 - 26所示postconception weeks), ST2: early infancy to late childhood (4 months to 11 years), and ST3: adolescence to adulthood (13 - 23 years)
The bar shown representes the lower 25% and upper 25% of the expression distribution.

Top co-expressed genes in brain regions

Top 10 positively co-expressed genes
Gene Pearson's Correlation Spearman's Correlation
UBR3 0.95 0.96
DMXL2 0.94 0.94
TMEM30A 0.94 0.94
ATP6V1A 0.93 0.94
CLTC 0.93 0.93
PJA2 0.93 0.94
DNAJC6 0.93 0.92
BAG4 0.92 0.94
COL4A3BP 0.92 0.93
AC010896.1 0.92 0.94
Top 10 negatively co-expressed genes
Gene Pearson's Correlation Spearman's Correlation
RAB34 -0.56 -0.64
C1orf61 -0.55 -0.72
DBI -0.53 -0.62
C1orf54 -0.53 -0.61
HIGD1B -0.52 -0.56
AP002478.3 -0.52 -0.59
FXYD1 -0.51 -0.54
EFEMP2 -0.51 -0.55
SAT1 -0.51 -0.59
PLA2G5 -0.51 -0.53

Section III. Gene Ontology annotation

Molecular function 去的术语 Evidence Neuro keywords PubMed ID
GO:0003677 DNA binding IEA -
GO:0008270 zinc ion binding IEA -
GO:0016564 transcription repressor activity IDA 10660046
GO:0016563 transcription activator activity IDA 10660046
GO:0046872 metal ion binding IEA -
Biological process 去的术语 Evidence Neuro keywords PubMed ID
GO:0007399 nervous system development IEA neurite (GO term level: 5) -
GO:0006355 regulation of transcription, DNA-dependent IEA -
GO:0007275 multicellular organismal development IEA -
GO:0016481 negative regulation of transcription IDA 10660046
GO:0030154 cell differentiation IEA -
GO:0045941 positive regulation of transcription IDA 10660046
Cellular component 去的术语 Evidence Neuro keywords PubMed ID
GO:0005622 intracellular IEA -
GO:0005634 nucleus IDA 10660046

Section V. Pathway annotation

Pathway name Pathway size # SZGR 2.0 genes in pathway Info
ONKEN UVEAL MELANOMA DN 526 357 All SZGR 2.0 genes in this pathway
VECCHI GASTRIC CANCER ADVANCED VS EARLY UP 175 120 All SZGR 2.0 genes in this pathway
KINSEY TARGETS OF EWSR1 FLII FUSION DN 329 219 All SZGR 2.0 genes in this pathway
ASTON MAJOR DEPRESSIVE DISORDER UP 49 36 All SZGR 2.0 genes in this pathway
LI WILMS TUMOR VS FETAL KIDNEY 1 DN 163 115 All SZGR 2.0 genes in this pathway
HADDAD B LYMPHOCYTE PROGENITOR 293 193 All SZGR 2.0 genes in this pathway
LU AGING BRAIN UP 262 186 All SZGR 2.0 genes in this pathway
MCLACHLAN DENTAL CARIES DN 245 144 All SZGR 2.0 genes in this pathway
MOLENAAR TARGETS OF CCND1 AND CDK4 UP 67 48 All SZGR 2.0 genes in this pathway
BUCKANOVICH T LYMPHOCYTE HOMING ON TUMOR DN 24 16 All SZGR 2.0 genes in this pathway
BONCI TARGETS OF MIR15A AND MIR16 1 91 75 All SZGR 2.0 genes in this pathway
CAIRO LIVER DEVELOPMENT UP 166 105 All SZGR 2.0 genes in this pathway
HOELZEL NF1 TARGETS DN 115 73 All SZGR 2.0 genes in this pathway
PANGAS TUMOR SUPPRESSION BY SMAD1 AND SMAD5 UP 134 85 All SZGR 2.0 genes in this pathway
BILANGES SERUM SENSITIVE GENES 90 54 All SZGR 2.0 genes in this pathway
WAKABAYASHI ADIPOGENESIS PPARG BOUND 8D 658 397 All SZGR 2.0 genes in this pathway
LIM MAMMARY STEM CELL UP 489 314 All SZGR 2.0 genes in this pathway

Section VI. microRNA annotation

miRNA family Target position miRNA ID miRNA seq
UTR start UTR end Match method
miR-145 588 594 m8 hsa-miR-145 GUCCAGUUUUCCCAGGAAUCCCUU
miR-15/16/195/424/497 135 141 1A hsa-miR-15abrain UAGCAGCACAUAAUGGUUUGUG
hsa-miR-16brain UAGCAGCACGUAAAUAUUGGCG
hsa-miR-15bbrain UAGCAGCACAUCAUGGUUUACA
hsa-miR-195SZ UAGCAGCACAGAAAUAUUGGC
hsa-miR-424 CAGCAGCAAUUCAUGUUUUGAA
hsa-miR-497 CAGCAGCACACUGUGGUUUGU
miR-203.1 254 260 m8 hsa-miR-203 UGAAAUGUUUAGGACCACUAG
miR-204/211 649 656 1A,m8 hsa-miR-204brain UUCCCUUUGUCAUCCUAUGCCU
hsa-miR-211 UUCCCUUUGUCAUCCUUCGCCU
miR-216 174 180 1A hsa-miR-216 UAAUCUCAGCUGGCAACUGUG
miR-224 611 618 1A,m8 hsa-miR-224 CAAGUCACUAGUGGUUCCGUUUA
miR-23 608 614 m8 hsa-miR-23abrain AUCACAUUGCCAGGGAUUUCC
hsa-miR-23bbrain AUCACAUUGCCAGGGAUUACC
miR-323 608 614 1A hsa-miR-323brain GCACAUUACACGGUCGACCUCU
miR-328 56 62 m8 hsa-miR-328brain CUGGCCCUCUCUGCCCUUCCGU
miR-330 516 523 1A,m8 hsa-miR-330brain GCAAAGCACACGGCCUGCAGAGA
miR-369-3p 311 318 1A,m8 hsa-miR-369-3p AAUAAUACAUGGUUGAUCUUU
hsa-miR-369-3p AAUAAUACAUGGUUGAUCUUU
miR-374 140 147 1A,m8 hsa-miR-374 UUAUAAUACAACCUGAUAAGUG
hsa-miR-374 UUAUAAUACAACCUGAUAAGUG
miR-421 128 134 m8 hsa-miR-421 GGCCUCAUUAAAUGUUUGUUG
miR-496 104 110 1A hsa-miR-496 AUUACAUGGCCAAUCUC
miR-503 134 141 1A,m8 hsa-miR-503 UAGCAGCGGGAACAGUUCUGCAG