Gene Page:RHOBTB2
Summary?
GeneID | 23221 |
Symbol | RHOBTB2 |
Synonyms | DBC2 |
Description | Rho related BTB domain containing 2 |
Reference | MIM:607352|HGNC:HGNC:18756|Ensembl:ENSG00000008853|HPRD:06300|Vega:OTTHUMG00000097827 |
Gene type | protein-coding |
Map location | 8p21.3 |
Pascal p-value | 0.82 |
Sherlock p-value | 0.443 |
Fetal beta | -0.948 |
DMG | 1 (# studies) |
eGene | Myers' cis & trans 元 |
Support | CompositeSet Darnell FMRP targets |
Gene in Data Sources
Gene set name | Method of gene set | Description | Info |
---|---|---|---|
CV:PGCnp | Genome-wide Association Study | GWAS | |
DMG:Wockner_2014 | Genome-wide DNA methylation analysis | This dataset includes 4641 differentially methylated probes corresponding to 2929 unique genes between schizophrenia patients (n=24) and controls (n=24). | 1 |
GSMA_I | Genome scan meta-analysis | Psr: 0.031 | |
GSMA_IIA | Genome scan meta-analysis (All samples) | Psr: 0.03086 | |
GSMA_IIE | Genome scan meta-analysis (European-ancestry samples) | Psr: 0.00057 |
Section I. Genetics and epigenetics annotation
Differentially methylated gene
Probe | Chromosome | Position | Nearest gene | P (dis) | Beta (dis) | FDR (dis) | Study |
---|---|---|---|---|---|---|---|
cg07595301 | 8 | 22853351 | RHOBTB2 | 1.8E-4 | 0.347 | 0.034 | DMG:Wockner_2014 |
eQTL annotation
SNP ID | Chromosome | Position | eGene | Gene Entrez ID | pvalue | qvalue | TSS distance | eQTL type |
---|---|---|---|---|---|---|---|---|
snp_a-4218218 | 0 | RHOBTB2 | 23221 | 0.08 | trans | |||
rs1971 | chr17 | 41602517 | RHOBTB2 | 23221 | 0.08 | trans |
Section II. Transcriptome annotation
General gene expression (GTEx)
![Not available](http://www.tjghsg.com/bioinfo/SZGR/GeneImg/RHOBTB2_DE_GTEx.png)
Gene expression during devlopment (BrainCloud)
Footnote:
A total of 269 time points ploted, with n=38 fetal samples (x=1:38). Each triangle represents one time point.
Gene expression of temporal and spatial changes (BrainSpan)
Footnote:
SC: sub-cortical regions; SM: sensory-motor regions; FC: frontal cortex; and TP: temporal-parietal cortex
ST1: fetal (13 - 26 postconception weeks), ST2: early infancy to late childhood (4 months to 11 years), and ST3: adolescence to adulthood (13 - 23 years)
The bar shown representes the lower 25% and upper 25% of the expression distribution.
Top co-expressed genes in brain regions
Top 10 positively co-expressed genes | ||
Gene | Pearson's Correlation | Spearman's Correlation |
PITPNM3 | 0.92 | 0.89 |
IQSEC2 | 0.92 | 0.87 |
SHANK1 | 0.91 | 0.89 |
OTUD7A | 0.91 | 0.87 |
SYNPO | 0.91 | 0.87 |
IQSEC1 | 0.90 | 0.90 |
SNPH | 0.90 | 0.93 |
C2orf55 | 0.90 | 0.80 |
IQSEC3 | 0.90 | 0.93 |
PACSIN1 | 0.90 | 0.85 |
Top 10 negatively co-expressed genes | ||
Gene | Pearson's Correlation | Spearman's Correlation |
RPL23A | -0.50 | -0.57 |
C9orf46 | -0.50 | -0.53 |
EXOSC8 | -0.49 | -0.47 |
BCL7C | -0.49 | -0.54 |
RPL32 | -0.47 | -0.50 |
RPS13P2 | -0.47 | -0.50 |
RPS18 | -0.47 | -0.50 |
RPS8 | -0.46 | -0.52 |
RPS6 | -0.46 | -0.52 |
DYNLT1 | -0.46 | -0.54 |
Section III. Gene Ontology annotation
Molecular function | 去term | Evidence | Neuro keywords | PubMed ID |
---|---|---|---|---|
去:0000166 | nucleotide binding | IEA | - | |
去:0005515 | protein binding | IEA | - | |
去:0005525 | GTP binding | IEA | - | |
Biological process | 去term | Evidence | Neuro keywords | PubMed ID |
去:0007264 | small GTPase mediated signal transduction | IEA | - | |
Cellular component | 去term | Evidence | Neuro keywords | PubMed ID |
去:0005622 | intracellular | IEA | - |
Section V. Pathway annotation
Pathway name | Pathway size | # SZGR 2.0 genes in pathway | Info |
---|---|---|---|
KEGG UBIQUITIN MEDIATED PROTEOLYSIS | 138 | 98 | All SZGR 2.0 genes in this pathway |
REACTOME SIGNALING BY RHO GTPASES | 113 | 81 | All SZGR 2.0 genes in this pathway |
ZHOU INFLAMMATORY RESPONSE LIVE DN | 384 | 220 | All SZGR 2.0 genes in this pathway |
ZHOU INFLAMMATORY RESPONSE FIMA DN | 284 | 156 | All SZGR 2.0 genes in this pathway |
DODD NASOPHARYNGEAL CARCINOMA UP | 1821 | 933 | All SZGR 2.0 genes in this pathway |
GRAESSMANN APOPTOSIS BY DOXORUBICIN DN | 1781 | 1082 | All SZGR 2.0 genes in this pathway |
SCHAEFFER PROSTATE DEVELOPMENT 48HR DN | 428 | 306 | All SZGR 2.0 genes in this pathway |
ZHANG RESPONSE TO IKK INHIBITOR AND TNF DN | 103 | 64 | All SZGR 2.0 genes in this pathway |
BAELDE DIABETIC NEPHROPATHY DN | 434 | 302 | All SZGR 2.0 genes in this pathway |
SATO SILENCED BY METHYLATION IN PANCREATIC CANCER 1 | 419 | 273 | All SZGR 2.0 genes in this pathway |
DOUGLAS BMI1 TARGETS UP | 566 | 371 | All SZGR 2.0 genes in this pathway |
SHEDDEN肺癌好生存A4 | 196 | 124 | All SZGR 2.0 genes in this pathway |
KASLER HDAC7 TARGETS 1 UP | 194 | 133 | All SZGR 2.0 genes in this pathway |
DELACROIX RARG BOUND MEF | 367 | 231 | All SZGR 2.0 genes in this pathway |
ZWANG EGF PERSISTENTLY UP | 32 | 24 | All SZGR 2.0 genes in this pathway |
Section VI. microRNA annotation
miRNA family | Target position | miRNA ID | miRNA seq | ||
---|---|---|---|---|---|
UTR start | UTR end | Match method | |||
miR-129-5p | 874 | 881 | 1A,m8 | hsa-miR-129brain | CUUUUUGCGGUCUGGGCUUGC |
hsa-miR-129-5p | CUUUUUGCGGUCUGGGCUUGCU | ||||
miR-370 | 1411 | 1417 | 1A | hsa-miR-370brain | GCCUGCUGGGGUGGAACCUGG |
miR-410 | 2667 | 2673 | 1A | hsa-miR-410 | AAUAUAACACAGAUGGCCUGU |
miR-450 | 874 | 880 | 1A | hsa-miR-450 | UUUUUGCGAUGUGUUCCUAAUA |
- SZ: miRNAs which differentially expressed in brain cortex of schizophrenia patients comparing with control samples using microarray. Clickhereto see the list of SZ related miRNAs.
- Brain: miRNAs which are expressed in brain based on miRNA microarray expression studies. Clickhereto see the list of brain related miRNAs.