Gene Page:RHOBTB2

Summary?
GeneID 23221
Symbol RHOBTB2
Synonyms DBC2
Description Rho related BTB domain containing 2
Reference MIM:607352|HGNC:HGNC:18756|Ensembl:ENSG00000008853|HPRD:06300|Vega:OTTHUMG00000097827
Gene type protein-coding
Map location 8p21.3
Pascal p-value 0.82
Sherlock p-value 0.443
Fetal beta -0.948
DMG 1 (# studies)
eGene Myers' cis & trans
元
Support CompositeSet
Darnell FMRP targets

Gene in Data Sources
Gene set name Method of gene set Description Info
CV:PGCnp Genome-wide Association Study GWAS
DMG:Wockner_2014 Genome-wide DNA methylation analysis This dataset includes 4641 differentially methylated probes corresponding to 2929 unique genes between schizophrenia patients (n=24) and controls (n=24). 1
GSMA_I Genome scan meta-analysis Psr: 0.031
GSMA_IIA Genome scan meta-analysis (All samples) Psr: 0.03086
GSMA_IIE Genome scan meta-analysis (European-ancestry samples) Psr: 0.00057

Section I. Genetics and epigenetics annotation

@Differentially methylated gene

Probe Chromosome Position Nearest gene P (dis) Beta (dis) FDR (dis) Study
cg07595301 8 22853351 RHOBTB2 1.8E-4 0.347 0.034 DMG:Wockner_2014

@eQTL annotation

SNP ID Chromosome Position eGene Gene Entrez ID pvalue qvalue TSS distance eQTL type
snp_a-4218218 0 RHOBTB2 23221 0.08 trans
rs1971 chr17 41602517 RHOBTB2 23221 0.08 trans

Section II. Transcriptome annotation

General gene expression (GTEx)

Not available

Gene expression during devlopment (BrainCloud)

Footnote:
A total of 269 time points ploted, with n=38 fetal samples (x=1:38). Each triangle represents one time point.

Gene expression of temporal and spatial changes (BrainSpan)

Footnote:
SC: sub-cortical regions; SM: sensory-motor regions; FC: frontal cortex; and TP: temporal-parietal cortex
ST1: fetal (13 - 26 postconception weeks), ST2: early infancy to late childhood (4 months to 11 years), and ST3: adolescence to adulthood (13 - 23 years)
The bar shown representes the lower 25% and upper 25% of the expression distribution.

Top co-expressed genes in brain regions

Top 10 positively co-expressed genes
Gene Pearson's Correlation Spearman's Correlation
PITPNM3 0.92 0.89
IQSEC2 0.92 0.87
SHANK1 0.91 0.89
OTUD7A 0.91 0.87
SYNPO 0.91 0.87
IQSEC1 0.90 0.90
SNPH 0.90 0.93
C2orf55 0.90 0.80
IQSEC3 0.90 0.93
PACSIN1 0.90 0.85
Top 10 negatively co-expressed genes
Gene Pearson's Correlation Spearman's Correlation
RPL23A -0.50 -0.57
C9orf46 -0.50 -0.53
EXOSC8 -0.49 -0.47
BCL7C -0.49 -0.54
RPL32 -0.47 -0.50
RPS13P2 -0.47 -0.50
RPS18 -0.47 -0.50
RPS8 -0.46 -0.52
RPS6 -0.46 -0.52
DYNLT1 -0.46 -0.54

Section III. Gene Ontology annotation

Molecular function 去term Evidence Neuro keywords PubMed ID
去:0000166 nucleotide binding IEA -
去:0005515 protein binding IEA -
去:0005525 GTP binding IEA -
Biological process 去term Evidence Neuro keywords PubMed ID
去:0007264 small GTPase mediated signal transduction IEA -
Cellular component 去term Evidence Neuro keywords PubMed ID
去:0005622 intracellular IEA -

Section V. Pathway annotation

Pathway name Pathway size # SZGR 2.0 genes in pathway Info
KEGG UBIQUITIN MEDIATED PROTEOLYSIS 138 98 All SZGR 2.0 genes in this pathway
REACTOME SIGNALING BY RHO GTPASES 113 81 All SZGR 2.0 genes in this pathway
ZHOU INFLAMMATORY RESPONSE LIVE DN 384 220 All SZGR 2.0 genes in this pathway
ZHOU INFLAMMATORY RESPONSE FIMA DN 284 156 All SZGR 2.0 genes in this pathway
DODD NASOPHARYNGEAL CARCINOMA UP 1821 933 All SZGR 2.0 genes in this pathway
GRAESSMANN APOPTOSIS BY DOXORUBICIN DN 1781 1082 All SZGR 2.0 genes in this pathway
SCHAEFFER PROSTATE DEVELOPMENT 48HR DN 428 306 All SZGR 2.0 genes in this pathway
ZHANG RESPONSE TO IKK INHIBITOR AND TNF DN 103 64 All SZGR 2.0 genes in this pathway
BAELDE DIABETIC NEPHROPATHY DN 434 302 All SZGR 2.0 genes in this pathway
SATO SILENCED BY METHYLATION IN PANCREATIC CANCER 1 419 273 All SZGR 2.0 genes in this pathway
DOUGLAS BMI1 TARGETS UP 566 371 All SZGR 2.0 genes in this pathway
SHEDDEN肺癌好生存A4 196 124 All SZGR 2.0 genes in this pathway
KASLER HDAC7 TARGETS 1 UP 194 133 All SZGR 2.0 genes in this pathway
DELACROIX RARG BOUND MEF 367 231 All SZGR 2.0 genes in this pathway
ZWANG EGF PERSISTENTLY UP 32 24 All SZGR 2.0 genes in this pathway

Section VI. microRNA annotation

miRNA family Target position miRNA ID miRNA seq
UTR start UTR end Match method
miR-129-5p 874 881 1A,m8 hsa-miR-129brain CUUUUUGCGGUCUGGGCUUGC
hsa-miR-129-5p CUUUUUGCGGUCUGGGCUUGCU
miR-370 1411 1417 1A hsa-miR-370brain GCCUGCUGGGGUGGAACCUGG
miR-410 2667 2673 1A hsa-miR-410 AAUAUAACACAGAUGGCCUGU
miR-450 874 880 1A hsa-miR-450 UUUUUGCGAUGUGUUCCUAAUA