Gene Page:SIK2
Summary?
GeneID | 23235 |
Symbol | SIK2 |
Synonyms | LOH11CR1I|QIK|SIK-2|SNF1LK2 |
Description | salt inducible kinase 2 |
Reference | MIM:608973|HGNC:HGNC:21680|HPRD:12348| |
Gene type | protein-coding |
Map location | 11q23.1 |
Pascal p-value | 0.982 |
DMG | 1 (# studies) |
Support | Ascano FMRP targets |
Gene in Data Sources
Gene set name | Method of gene set | Description | Info |
---|---|---|---|
CV:PGCnp | Genome-wide Association Study | GWAS | |
DMG:Jaffe_2016 | Genome-wide DNA methylation analysis | This dataset includes 2,104 probes/CpGs associated with SZ patients (n=108) compared to 136 controls at Bonferroni-adjusted P < 0.05. | 1 |
PMID:cooccur | High-throughput literature-search | 系统搜索PubMed genes co-occurring with SCZ keywords. A total of 3027 genes were included. | |
Literature | High-throughput literature-search | Co-occurance with Schizophrenia keywords: schizophrenia,schizophrenias | Click to show details |
Section I. Genetics and epigenetics annotation
Differentially methylated gene
Probe | Chromosome | Position | Nearest gene | P (dis) | Beta (dis) | FDR (dis) | Study |
---|---|---|---|---|---|---|---|
cg21419428 | 11 | 111473938 | SIK2 | 1.14E-8 | -0.011 | 4.8E-6 | DMG:Jaffe_2016 |
Section II. Transcriptome annotation
General gene expression (GTEx)
![Not available](http://www.tjghsg.com/bioinfo/SZGR/GeneImg/SIK2_DE_GTEx.png)
Gene expression of temporal and spatial changes (BrainSpan)
Footnote:
SC: sub-cortical regions; SM: sensory-motor regions; FC: frontal cortex; and TP: temporal-parietal cortex
ST1: fetal (13 - 26 postconception weeks), ST2: early infancy to late childhood (4 months to 11 years), and ST3: adolescence to adulthood (13 - 23 years)
The bar shown representes the lower 25% and upper 25% of the expression distribution.
Top co-expressed genes in brain regions
Top 10 positively co-expressed genes | ||
Gene | Pearson's Correlation | Spearman's Correlation |
TCTEX1D2 | 0.80 | 0.87 |
NDUFS4 | 0.80 | 0.83 |
NDUFAF2 | 0.80 | 0.82 |
TXN | 0.78 | 0.75 |
GTF2A2 | 0.78 | 0.82 |
ATP5E | 0.78 | 0.74 |
CHCHD1 | 0.78 | 0.81 |
TXNDC17 | 0.77 | 0.79 |
ARL16 | 0.77 | 0.77 |
SNRPD2 | 0.77 | 0.77 |
Top 10 negatively co-expressed genes | ||
Gene | Pearson's Correlation | Spearman's Correlation |
AF347015.15 | -0.56 | -0.66 |
AF347015.26 | -0.55 | -0.67 |
EPAS1 | -0.55 | -0.68 |
MMRN2 | -0.54 | -0.57 |
AF347015.2 | -0.54 | -0.64 |
AF347015.8 | -0.53 | -0.62 |
MT-CYB | -0.53 | -0.62 |
TGM2 | -0.53 | -0.62 |
PRELP | -0.53 | -0.65 |
HLA-E | -0.53 | -0.65 |
Section III. Gene Ontology annotation
Molecular function | 去的术语 | Evidence | Neuro keywords | PubMed ID |
---|---|---|---|---|
GO:0000166 | nucleotide binding | IEA | - | |
GO:0000287 | magnesium ion binding | IDA | 14976552 | |
GO:0005515 | protein binding | IEA | - | |
GO:0005524 | ATP binding | IDA | 14976552 | |
GO:0004674 | protein serine/threonine kinase activity | IDA | 14976552 | |
GO:0016740 | transferase activity | IEA | - | |
Biological process | 去的术语 | Evidence | Neuro keywords | PubMed ID |
GO:0006468 | protein amino acid phosphorylation | IDA | 14976552 | |
GO:0007243 | protein kinase cascade | IDA | 14976552 | |
GO:0046626 | regulation of insulin receptor signaling pathway | ISS | - | |
Cellular component | 去的术语 | Evidence | Neuro keywords | PubMed ID |
GO:0005634 | nucleus | IEA | - | |
GO:0005737 | cytoplasm | ISS | - |
Section V. Pathway annotation
Pathway name | Pathway size | # SZGR 2.0 genes in pathway | Info |
---|---|---|---|
PID LKB1 PATHWAY | 47 | 37 | All SZGR 2.0 genes in this pathway |
CHEMNITZ RESPONSE TO PROSTAGLANDIN E2 DN | 391 | 222 | All SZGR 2.0 genes in this pathway |
OSWALD HEMATOPOIETIC STEM CELL IN COLLAGEN GEL DN | 275 | 168 | All SZGR 2.0 genes in this pathway |
KANG GIST WITH PDGFRA UP | 50 | 27 | All SZGR 2.0 genes in this pathway |
OKUMURA INFLAMMATORY RESPONSE LPS | 183 | 115 | All SZGR 2.0 genes in this pathway |
AMUNDSON POOR SURVIVAL AFTER GAMMA RADIATION 2G | 171 | 96 | All SZGR 2.0 genes in this pathway |
WAKABAYASHI ADIPOGENESIS PPARG BOUND 8D | 658 | 397 | All SZGR 2.0 genes in this pathway |
Section VI. microRNA annotation
miRNA family | Target position | miRNA ID | miRNA seq | ||
---|---|---|---|---|---|
UTR start | UTR end | Match method | |||
miR-101 | 2686 | 2692 | 1A | hsa-miR-101 | UACAGUACUGUGAUAACUGAAG |
miR-103/107 | 1532 | 1539 | 1A,m8 | hsa-miR-103brain | AGCAGCAUUGUACAGGGCUAUGA |
hsa-miR-107brain | AGCAGCAUUGUACAGGGCUAUCA | ||||
miR-124/506 | 1038 | 1044 | m8 | hsa-miR-506 | UAAGGCACCCUUCUGAGUAGA |
hsa-miR-124brain | UAAGGCACGCGGUGAAUGCC | ||||
miR-137 | 1211 | 1217 | 1A | hsa-miR-137 | UAUUGCUUAAGAAUACGCGUAG |
miR-142-3p | 2682 | 2688 | m8 | hsa-miR-142-3p | UGUAGUGUUUCCUACUUUAUGGA |
miR-144 | 2686 | 2692 | 1A | hsa-miR-144 | UACAGUAUAGAUGAUGUACUAG |
miR-145 | 126 | 133 | 1A,m8 | hsa-miR-145 | GUCCAGUUUUCCCAGGAAUCCCUU |
miR-218 | 1508 | 1515 | 1A,m8 | hsa-miR-218brain | UUGUGCUUGAUCUAACCAUGU |
hsa-miR-218brain | UUGUGCUUGAUCUAACCAUGU | ||||
miR-329 | 2676 | 2682 | 1A | hsa-miR-329brain | AACACACCUGGUUAACCUCUUU |
- SZ: miRNAs which differentially expressed in brain cortex of schizophrenia patients comparing with control samples using microarray. Clickhereto see the list of SZ related miRNAs.
- Brain: miRNAs which are expressed in brain based on miRNA microarray expression studies. Clickhereto see the list of brain related miRNAs.