Gene Page:ASTN2

Summary?
GeneID 23245
Symbol ASTN2
Synonyms bA67K19.1
Description astrotactin 2
Reference MIM:612856|HGNC:HGNC:17021|Ensembl:ENSG00000148219|HPRD:12498|Vega:OTTHUMG00000021013
Gene type protein-coding
Map location 9q33.1
Pascal p-value 0.401
Sherlock p-value 0.002
Fetal beta 0.96
eGene Cerebellar Hemisphere
小脑
支持 G2Cdb.humanPSD
G2Cdb.humanPSP

Gene in Data Sources
Gene set name Method of gene set Description Info
CV:GWASdb Genome-wide Association Studies GWASdb records for schizophrenia
CV:PGCnp Genome-wide Association Study GWAS
PMID:cooccur High-throughput literature-search Systematic search in PubMed for genes co-occurring with SCZ keywords. A total of 3027 genes were included.
Literature High-throughput literature-search Co-occurance with Schizophrenia keywords: schizophrenia,schizophrenias Click to show details

Section I. Genetics and epigenetics annotation


Section II. Transcriptome annotation

General gene expression (GTEx)

Not available

Gene expression during devlopment (BrainCloud)

Footnote:
A total of 269 time points ploted, with n=38 fetal samples (x=1:38). Each triangle represents one time point.

Gene expression of temporal and spatial changes (BrainSpan)

Footnote:
SC: sub-cortical regions; SM: sensory-motor regions; FC: frontal cortex; and TP: temporal-parietal cortex
ST1: fetal (13 - 26 postconception weeks), ST2: early infancy to late childhood (4 months to 11 years), and ST3: adolescence to adulthood (13 - 23 years)
The bar shown representes the lower 25% and upper 25% of the expression distribution.

No co-expressed genes in brain regions


Section III. Gene Ontology annotation

Cellular component 去你rm Evidence Neuro keywords PubMed ID
GO:0016020 membrane IEA -
GO:0016021 integral to membrane IEA -

Section V. Pathway annotation

Pathway name Pathway size # SZGR 2.0 genes in pathway Info
ONKEN UVEAL MELANOMA UP 783 507 All SZGR 2.0 genes in this pathway
CHEMNITZ RESPONSE TO PROSTAGLANDIN E2 DN 391 222 All SZGR 2.0 genes in this pathway
DAVICIONI MOLECULAR ARMS VS ERMS UP 332 228 All SZGR 2.0 genes in this pathway
CHARAFE BREAST CANCER LUMINAL VS BASAL UP 380 215 All SZGR 2.0 genes in this pathway
WANG CLIM2 TARGETS UP 269 146 All SZGR 2.0 genes in this pathway
LINDGREN BLADDER CANCER CLUSTER 1 UP 121 71 All SZGR 2.0 genes in this pathway
LINDGREN BLADDER CANCER WITH LOH IN CHR9Q 116 71 All SZGR 2.0 genes in this pathway
EBAUER TARGETS OF PAX3 FOXO1 FUSION DN 48 31 All SZGR 2.0 genes in this pathway
THEODOROU MAMMARY TUMORIGENESIS 31 24 All SZGR 2.0 genes in this pathway
PUJANA BRCA1 PCC NETWORK 1652 1023 All SZGR 2.0 genes in this pathway
BENPORATH SUZ12 TARGETS 1038 678 All SZGR 2.0 genes in this pathway
BENPORATH EED TARGETS 1062 725 All SZGR 2.0 genes in this pathway
BENPORATH ES WITH H3K27ME3 1118 744 All SZGR 2.0 genes in this pathway
BENPORATH PRC2 TARGETS 652 441 All SZGR 2.0 genes in this pathway
HANN RESISTANCE TO BCL2 INHIBITOR DN 48 31 All SZGR 2.0 genes in this pathway
ACEVEDO METHYLATED IN LIVER CANCER DN 940 425 All SZGR 2.0 genes in this pathway
SMID BREAST CANCER RELAPSE IN BRAIN DN 85 58 All SZGR 2.0 genes in this pathway
SMID BREAST CANCER BASAL DN 701 446 All SZGR 2.0 genes in this pathway
PEDRIOLI MIR31 TARGETS UP 221 120 All SZGR 2.0 genes in this pathway
KUMAR PATHOGEN LOAD BY MACROPHAGES 275 155 All SZGR 2.0 genes in this pathway
SMIRNOV RESPONSE TO IR 6HR UP 166 97 All SZGR 2.0 genes in this pathway

Section VI. microRNA annotation

miRNA family Target position miRNA ID miRNA seq
UTR start UTR end Match method
miR-155 338 344 1A hsa-miR-155 UUAAUGCUAAUCGUGAUAGGGG