Gene Page:SIRT1
Summary?
GeneID | 23411 |
Symbol | SIRT1 |
Synonyms | SIR2|SIR2L1|SIR2alpha |
Description | sirtuin 1 |
Reference | MIM:604479|HGNC:HGNC:14929|Ensembl:ENSG00000096717|HPRD:08381|Vega:OTTHUMG00000018340 |
Gene type | protein-coding |
Map location | 10q21.3 |
Pascal p-value | 0.112 |
Sherlock p-value | 0.004 |
Fetal beta | 1.189 |
Support | Chromatin Remodeling Genes |
Gene in Data Sources
Gene set name | Method of gene set | Description | Info |
---|---|---|---|
CV:PGCnp | Genome-wide Association Study | GWAS | |
PMID:cooccur | High-throughput literature-search | Systematic search in PubMed for genes co-occurring with SCZ keywords. A total of 3027 genes were included. | |
Literature | High-throughput literature-search | Co-occurance with Schizophrenia keywords: schizophrenia,schizophrenias | Click to show details |
GO_Annotation | Mapping neuro-related keywords to Gene Ontology annotations | Hits with neuro-related keywords: 1 |
Section I. Genetics and epigenetics annotation
Section II. Transcriptome annotation
General gene expression (GTEx)
![Not available](http://www.tjghsg.com/bioinfo/SZGR/GeneImg/SIRT1_DE_GTEx.png)
Gene expression during devlopment (BrainCloud)
Footnote:
A total of 269 time points ploted, with n=38 fetal samples (x=1:38). Each triangle represents one time point.
Gene expression of temporal and spatial changes (BrainSpan)
Footnote:
SC: sub-cortical regions; SM: sensory-motor regions; FC: frontal cortex; and TP: temporal-parietal cortex
ST1: fetal (13 - 26 postconception weeks), ST2: early infancy to late childhood (4 months to 11 years), and ST3: adolescence to adulthood (13 - 23 years)
The bar shown representes the lower 25% and upper 25% of the expression distribution.
Top co-expressed genes in brain regions
Top 10 positively co-expressed genes | ||
Gene | Pearson's Correlation | Spearman's Correlation |
AC008073.1 | 0.90 | 0.89 |
ERH | 0.90 | 0.91 |
RPL17P20 | 0.87 | 0.88 |
SARNP | 0.87 | 0.87 |
PSMA2 | 0.86 | 0.87 |
C18orf21 | 0.86 | 0.86 |
RPL6P10 | 0.85 | 0.87 |
RPL26L1 | 0.85 | 0.87 |
PSMB7 | 0.85 | 0.86 |
EIF3M | 0.85 | 0.88 |
Top 10 negatively co-expressed genes | ||
Gene | Pearson's Correlation | Spearman's Correlation |
AF347015.15 | -0.61 | -0.71 |
AF347015.8 | -0.60 | -0.69 |
AF347015.27 | -0.60 | -0.68 |
MT-CYB | -0.60 | -0.69 |
TINAGL1 | -0.60 | -0.69 |
AF347015.26 | -0.59 | -0.73 |
SLC6A12 | -0.59 | -0.68 |
AF347015.2 | -0.59 | -0.70 |
EPAS1 | -0.59 | -0.70 |
AF347015.33 | -0.58 | -0.67 |
Section III. Gene Ontology annotation
Molecular function | GO term | Evidence | Neuro keywords | PubMed ID |
---|---|---|---|---|
GO:0003950 | NAD+ ADP-ribosyltransferase activity | TAS | 10381378 | |
GO:0003677 | DNA binding | IEA | - | |
GO:0008270 | zinc ion binding | IEA | - | |
GO:0008022 | protein C-terminus binding | IPI | 18203716 | |
GO:0017136 | NAD-dependent histone deacetylase activity | IDA | 16959573 | |
GO:0016564 | transcription repressor activity | IEA | - | |
GO:0051287 | NAD binding | IEA | - | |
GO:0019213 | deacetylase activity | IDA | 18203716 | |
GO:0046872 | metal ion binding | IEA | - | |
Biological process | GO term | Evidence | Neuro keywords | PubMed ID |
GO:0007519 | skeletal muscle development | IEA | neuron (GO term level: 8) | - |
GO:0001542 | ovulation from ovarian follicle | IEA | - | |
GO:0006355 | regulation of transcription, DNA-dependent | IEA | - | |
GO:0006471 | protein amino acid ADP-ribosylation | TAS | 10381378 | |
GO:0006342 | chromatin silencing | TAS | 10381378 | |
GO:0007283 | spermatogenesis | IEA | - | |
GO:0006974 | response to DNA damage stimulus | IDA | 18203716 | |
GO:0006915 | apoptosis | IEA | - | |
去:0007275 | multicellular organismal development | IEA | - | |
GO:0016481 | negative regulation of transcription | IEA | - | |
GO:0030154 | cell differentiation | IEA | - | |
GO:0033158 | regulation of protein import into nucleus, translocation | IMP | 18203716 | |
GO:0051097 | negative regulation of helicase activity | IDA | 18203716 | |
GO:0016575 | histone deacetylation | IEA | - | |
GO:0044419 | interspecies interaction between organisms | IEA | - | |
Cellular component | GO term | Evidence | Neuro keywords | PubMed ID |
GO:0005634 | nucleus | IEA | - | |
GO:0005677 | chromatin silencing complex | IEA | - | |
GO:0005737 | cytoplasm | IDA | 18029348 |
Section V. Pathway annotation
Pathway name | Pathway size | # SZGR 2.0 genes in pathway | Info |
---|---|---|---|
BIOCARTA PML PATHWAY | 17 | 12 | All SZGR 2.0 genes in this pathway |
PID P73PATHWAY | 79 | 59 | All SZGR 2.0 genes in this pathway |
PID HDAC CLASSIII PATHWAY | 25 | 20 | All SZGR 2.0 genes in this pathway |
PID E2F PATHWAY | 74 | 48 | All SZGR 2.0 genes in this pathway |
PID HIF2PATHWAY | 34 | 29 | All SZGR 2.0 genes in this pathway |
PID HDAC CLASSI PATHWAY | 66 | 50 | All SZGR 2.0 genes in this pathway |
PID FOXO PATHWAY | 49 | 43 | All SZGR 2.0 genes in this pathway |
PID AR TF PATHWAY | 53 | 38 | All SZGR 2.0 genes in this pathway |
PID RB 1PATHWAY | 65 | 46 | All SZGR 2.0 genes in this pathway |
FULCHER INFLAMMATORY RESPONSE LECTIN VS LPS DN | 463 | 290 | All SZGR 2.0 genes in this pathway |
DIAZ CHRONIC MEYLOGENOUS LEUKEMIA UP | 1382 | 904 | All SZGR 2.0 genes in this pathway |
GARGALOVIC应对氧化磷脂LIGHTYELLOW UP | 11 | 8 | All SZGR 2.0 genes in this pathway |
KIM WT1 TARGETS DN | 459 | 276 | All SZGR 2.0 genes in this pathway |
ENK UV RESPONSE EPIDERMIS DN | 508 | 354 | All SZGR 2.0 genes in this pathway |
GRAESSMANN APOPTOSIS BY DOXORUBICIN UP | 1142 | 669 | All SZGR 2.0 genes in this pathway |
LASTOWSKA NEUROBLASTOMA COPY NUMBER DN | 800 | 473 | All SZGR 2.0 genes in this pathway |
BUYTAERT PHOTODYNAMIC THERAPY STRESS UP | 811 | 508 | All SZGR 2.0 genes in this pathway |
BENPORATH ES 1 | 379 | 235 | All SZGR 2.0 genes in this pathway |
BENPORATH MYC TARGETS WITH EBOX | 230 | 156 | All SZGR 2.0 genes in this pathway |
GEORGES TARGETS OF MIR192 AND MIR215 | 893 | 528 | All SZGR 2.0 genes in this pathway |
SHEPARD BMYB MORPHOLINO UP | 205 | 126 | All SZGR 2.0 genes in this pathway |
MCCLUNG COCAIN REWARD 4WK | 75 | 47 | All SZGR 2.0 genes in this pathway |
MARTINEZ RESPONSE TO TRABECTEDIN DN | 271 | 175 | All SZGR 2.0 genes in this pathway |
MARSON BOUND BY FOXP3 UNSTIMULATED | 1229 | 713 | All SZGR 2.0 genes in this pathway |
ACEVEDO LIVER CANCER WITH H3K9ME3 UP | 141 | 75 | All SZGR 2.0 genes in this pathway |
BONOME OVARIAN CANCER POOR SURVIVAL UP | 31 | 22 | All SZGR 2.0 genes in this pathway |
BONOME OVARIAN CANCER SURVIVAL SUBOPTIMAL DEBULKING | 510 | 309 | All SZGR 2.0 genes in this pathway |
MATZUK OVULATION | 14 | 10 | All SZGR 2.0 genes in this pathway |
MATZUK SPERMATOZOA | 114 | 77 | All SZGR 2.0 genes in this pathway |
WEST ADRENOCORTICAL TUMOR DN | 546 | 362 | All SZGR 2.0 genes in this pathway |
MUELLER PLURINET | 299 | 189 | All SZGR 2.0 genes in this pathway |
DANG BOUND BY MYC | 1103 | 714 | All SZGR 2.0 genes in this pathway |
PILON KLF1 TARGETS DN | 1972 | 1213 | All SZGR 2.0 genes in this pathway |
ZWANG TRANSIENTLY UP BY 2ND EGF PULSE ONLY | 1725 | 838 | All SZGR 2.0 genes in this pathway |
Section VI. microRNA annotation
miRNA family | 目标位置 | miRNA ID | miRNA seq | ||
---|---|---|---|---|---|
UTR start | UTR end | Match method | |||
miR-124.1 | 1211 | 1218 | 1A,m8 | hsa-miR-124a | UUAAGGCACGCGGUGAAUGCCA |
miR-124/506 | 1211 | 1217 | 1A | hsa-miR-506 | UAAGGCACCCUUCUGAGUAGA |
hsa-miR-124brain | UAAGGCACGCGGUGAAUGCC | ||||
miR-128 | 849 | 855 | m8 | hsa-miR-128a | UCACAGUGAACCGGUCUCUUUU |
hsa-miR-128b | UCACAGUGAACCGGUCUCUUUC | ||||
miR-132/212 | 1614 | 1620 | m8 | hsa-miR-212SZ | UAACAGUCUCCAGUCACGGCC |
hsa-miR-132brain | UAACAGUCUACAGCCAUGGUCG | ||||
miR-135 | 358 | 364 | m8 | hsa-miR-135a | UAUGGCUUUUUAUUCCUAUGUGA |
hsa-miR-135b | UAUGGCUUUUCAUUCCUAUGUG | ||||
miR-138 | 32 | 39 | 1A,m8 | hsa-miR-138brain | AGCUGGUGUUGUGAAUC |
miR-141/200a | 1728 | 1734 | m8 | hsa-miR-141 | UAACACUGUCUGGUAAAGAUGG |
hsa-miR-200a | UAACACUGUCUGGUAACGAUGU | ||||
miR-153 | 907 | 913 | 1A | hsa-miR-153 | UUGCAUAGUCACAAAAGUGA |
miR-181 | 63 | 69 | m8 | hsa-miR-181abrain | AACAUUCAACGCUGUCGGUGAGU |
hsa-miR-181bSZ | AACAUUCAUUGCUGUCGGUGGG | ||||
hsa-miR-181cbrain | AACAUUCAACCUGUCGGUGAGU | ||||
hsa-miR-181dbrain | AACAUUCAUUGUUGUCGGUGGGUU | ||||
miR-186 | 1400 | 1406 | 1A | hsa-miR-186 | CAAAGAAUUCUCCUUUUGGGCUU |
miR-199 | 507 | 513 | m8 | hsa-miR-199a | CCCAGUGUUCAGACUACCUGUUC |
hsa-miR-199b | CCCAGUGUUUAGACUAUCUGUUC | ||||
miR-204/211 | 384 | 391 | 1A,m8 | hsa-miR-204brain | UUCCCUUUGUCAUCCUAUGCCU |
hsa-miR-211 | UUCCCUUUGUCAUCCUUCGCCU | ||||
miR-217 | 1519 | 1526 | 1A,m8 | hsa-miR-217 | UACUGCAUCAGGAACUGAUUGGAU |
miR-22 | 530 | 537 | 1A,m8 | hsa-miR-22brain | AAGCUGCCAGUUGAAGAACUGU |
miR-23 | 899 | 906 | 1A,m8 | hsa-miR-23abrain | AUCACAUUGCCAGGGAUUUCC |
hsa-miR-23bbrain | AUCACAUUGCCAGGGAUUACC | ||||
miR-30-5p | 67 | 73 | m8 | hsa-miR-30a-5p | UGUAAACAUCCUCGACUGGAAG |
hsa-miR-30cbrain | UGUAAACAUCCUACACUCUCAGC | ||||
hsa-miR-30dSZ | UGUAAACAUCCCCGACUGGAAG | ||||
hsa-miR-30bSZ | UGUAAACAUCCUACACUCAGCU | ||||
hsa-miR-30e-5p | UGUAAACAUCCUUGACUGGA | ||||
miR-34/449 | 1434 | 1440 | 1A | hsa-miR-34abrain | UGGCAGUGUCUUAGCUGGUUGUU |
hsa-miR-34c | AGGCAGUGUAGUUAGCUGAUUGC | ||||
hsa-miR-449 | UGGCAGUGUAUUGUUAGCUGGU | ||||
hsa-miR-449b | AGGCAGUGUAUUGUUAGCUGGC | ||||
miR-369-3p | 1113 | 1119 | m8 | hsa-miR-369-3p | AAUAAUACAUGGUUGAUCUUU |
miR-448 | 906 | 913 | 1A,m8 | hsa-miR-448 | UUGCAUAUGUAGGAUGUCCCAU |
miR-485-3p | 280 | 286 | m8 | hsa-miR-485-3p | GUCAUACACGGCUCUCCUCUCU |
miR-494 | 765 | 772 | 1A,m8 | hsa-miR-494brain | UGAAACAUACACGGGAAACCUCUU |
miR-496 | 380 | 386 | 1A | hsa-miR-496 | AUUACAUGGCCAAUCUC |
miR-543 | 367 | 374 | 1A,m8 | hsa-miR-543 | AAACAUUCGCGGUGCACUUCU |
hsa-miR-543 | AAACAUUCGCGGUGCACUUCU | ||||
miR-9 | 404 | 411 | 1A,m8 | hsa-miR-9SZ | UCUUUGGUUAUCUAGCUGUAUGA |
- SZ: miRNAs which differentially expressed in brain cortex of schizophrenia patients comparing with control samples using microarray. Clickhereto see the list of SZ related miRNAs.
- Brain: miRNAs which are expressed in brain based on miRNA microarray expression studies. Clickhereto see the list of brain related miRNAs.