Gene Page:OTP

Summary?
GeneID 23440
Symbol OTP
Synonyms -
Description orthopedia homeobox
Reference MIM:604529|HGNC:HGNC:8518|HPRD:05166|
Gene type protein-coding
Map location 5q13.3
Pascal p-value 0.236
DMG 2 (# studies)
eGene Myers' cis & trans

Gene in Data Sources
Gene set name Method of gene set Description Info
CV:PGCnp Genome-wide Association Study GWAS
DMG:Jaffe_2016 Genome-wide DNA methylation analysis This dataset includes 2,104 probes/CpGs associated with SZ patients (n=108) compared to 136 controls at Bonferroni-adjusted P < 0.05. 2
DMG:Wockner_2014 Genome-wide DNA methylation analysis This dataset includes 4641 differentially methylated probes corresponding to 2929 unique genes between schizophrenia patients (n=24) and controls (n=24). 2
PMID:cooccur High-throughput literature-search Systematic search in PubMed for genes co-occurring with SCZ keywords. A total of 3027 genes were included.
Literature High-throughput literature-search 与精神分裂症Co-occurance关键词:schizophrenia,schizophrenic,schizophrenias Click to show details
GO_Annotation Mapping neuro-related keywords to Gene Ontology annotations Hits with neuro-related keywords: 1

Section I. Genetics and epigenetics annotation

@Differentially methylated gene

Probe Chromosome Position Nearest gene P (dis) Beta (dis) FDR (dis) Study
cg02164129 5 76926550 OTP 5.69E-5 -0.396 0.022 DMG:Wockner_2014
cg25547361 5 76926079 OTP 7.17E-10 -0.016 9.89E-7 DMG:Jaffe_2016

@eQTL annotation

SNP ID Chromosome Position eGene Gene Entrez ID pvalue qvalue TSS distance eQTL type
rs10994209 chr10 61877705 OTP 23440 0.16 trans

Section II. Transcriptome annotation

General gene expression (GTEx)

Not available

Gene expression of temporal and spatial changes (BrainSpan)

Footnote:
SC: sub-cortical regions; SM: sensory-motor regions; FC: frontal cortex; and TP: temporal-parietal cortex
ST1: fetal (13 - 26 postconception weeks), ST2: early infancy to late childhood (4 months to 11 years), and ST3: adolescence to adulthood (13 - 23 years)
The bar shown representes the lower 25% and upper 25% of the expression distribution.

No co-expressed genes in brain regions


Section III. Gene Ontology annotation

Molecular function GO term Evidence Neuro keywords PubMed ID
GO:0003700 transcription factor activity IEA -
GO:0043565 sequence-specific DNA binding IEA -
Biological process GO term Evidence Neuro keywords PubMed ID
GO:0007399 nervous system development IEA neurite (GO term level: 5) -
GO:0002052 positive regulation of neuroblast proliferation IEA -
GO:0006355 regulation of transcription, DNA-dependent IEA -
GO:0007275 multicellular organismal development IEA -
GO:0021985 neurohypophysis development IEA -
GO:0021979 hypothalamus cell differentiation IEA -
Cellular component GO term Evidence Neuro keywords PubMed ID
GO:0005634 nucleus IEA -

Section V. Pathway annotation

Pathway name Pathway size # SZGR 2.0 genes in pathway Info
BENPORATH SUZ12 TARGETS 1038 678 All SZGR 2.0 genes in this pathway
BENPORATH EED TARGETS 1062 725 All SZGR 2.0 genes in this pathway
BENPORATH ES WITH H3K27ME3 1118 744 All SZGR 2.0 genes in this pathway
BENPORATH PRC2 TARGETS 652 441 All SZGR 2.0 genes in this pathway
SHEPARD BMYB MORPHOLINO DN 200 112 All SZGR 2.0 genes in this pathway
SHEPARD BMYB TARGETS 74 41 All SZGR 2.0 genes in this pathway
SHEPARD CRUSH AND BURN MUTANT DN 185 111 All SZGR 2.0 genes in this pathway
BYSTRYKH HEMATOPOIESIS STEM CELL QTL TRANS 882 572 All SZGR 2.0 genes in this pathway
HANN RESISTANCE TO BCL2 INHIBITOR DN 48 31 All SZGR 2.0 genes in this pathway
MEISSNER NPC HCP WITH H3K27ME3 79 59 All SZGR 2.0 genes in this pathway
MEISSNER BRAIN HCP WITH H3K27ME3 269 159 All SZGR 2.0 genes in this pathway
MIKKELSEN IPS WITH HCP H3K27ME3 102 76 All SZGR 2.0 genes in this pathway
MIKKELSEN NPC HCP WITH H3K27ME3 341 243 All SZGR 2.0 genes in this pathway
MIKKELSEN MEF HCP WITH H3K27ME3 590 403 All SZGR 2.0 genes in this pathway

Section VI. microRNA annotation

miRNA family Target position miRNA ID miRNA seq
UTR start UTR end Match method
miR-194 1377 1383 1A hsa-miR-194 UGUAACAGCAACUCCAUGUGGA
miR-208 677 683 1A hsa-miR-208 AUAAGACGAGCAAAAAGCUUGU
miR-218 656 662 1A hsa-miR-218brain UUGUGCUUGAUCUAACCAUGU
miR-219 1265 1271 1A hsa-miR-219brain UGAUUGUCCAAACGCAAUUCU
miR-23 1340 1346 1A hsa-miR-23abrain AUCACAUUGCCAGGGAUUUCC
hsa-miR-23bbrain AUCACAUUGCCAGGGAUUACC
miR-326 1303 1310 1A,m8 hsa-miR-326 CCUCUGGGCCCUUCCUCCAG
miR-375 1332 1338 1A hsa-miR-375 UUUGUUCGUUCGGCUCGCGUGA
miR-499 677 683 1A hsa-miR-499 UUAAGACUUGCAGUGAUGUUUAA
miR-503 1142 1148 m8 hsa-miR-503 UAGCAGCGGGAACAGUUCUGCAG
miR-544 554 560 1A hsa-miR-544 AUUCUGCAUUUUUAGCAAGU