Gene Page:SF3B1

Summary?
GeneID 23451
Symbol SF3B1
Synonyms Hsh155|MDS|PRP10|PRPF10|SAP155|SF3b155
Description splicing factor 3b subunit 1
Reference MIM:605590|HGNC:HGNC:10768|Ensembl:ENSG00000115524|HPRD:09281|Vega:OTTHUMG00000154447
Gene type protein-coding
Map location 2q33.1
Pascal p-value 1.471E-10
Sherlock p-value 0.355
Fetal beta 0.888
DMG 1 (# studies)
eGene Caudate basal ganglia
Support AscanoFMRP targets

Gene in Data Sources
Gene set name Method of gene set Description Info
CV:GWAScat Genome-wide Association Studies This data set includes 560 SNPs associated with schizophrenia. A total of 486 genes were mapped to these SNPs within 50kb.
CV:PGC128 Genome-wide Association Study A multi-stage schizophrenia GWAS of up to 36,989 cases and 113,075 controls. Reported by the Schizophrenia Working Group of PGC. 128 independent associations spanning 108 loci
CV:PGCnp Genome-wide Association Study GWAS
DMG:Jaffe_2016 Genome-wide DNA methylation analysis This dataset includes 2,104 probes/CpGs associated with SZ patients (n=108) compared to 136 controls at Bonferroni-adjusted P < 0.05. 1
PMID:cooccur High-throughput literature-search 系统search in PubMed for genes co-occurring with SCZ keywords. A total of 3027 genes were included.
Expression Meta-analysis of gene expression Pvalue: 1.907
Literature High-throughput literature-search Co-occurance with Schizophrenia keywords: schizophrenia,schizophrenias Click to show details

Section I. Genetics and epigenetics annotation

@CV:PGC128

SNP ID Chromosome Position Allele P Function Gene Up/Down Distance
rs6434928 chr2 198304577 AG 1.478E-11 intergenic SF3B1,COQ10B dist=4760;dist=13654

@Differentially methylated gene

Probe Chromosome Position Nearest gene P (dis) Beta (dis) FDR (dis) Study
cg06750227 2 198298917 SF3B1 2.37E-8 -0.017 7.79E-6 DMG:Jaffe_2016


Section II. Transcriptome annotation

General gene expression (GTEx)

Not available

Gene expression during devlopment (BrainCloud)

Footnote:
A total of 269 time points ploted, with n=38 fetal samples (x=1:38). Each triangle represents one time point.

Gene expression of temporal and spatial changes (BrainSpan)

Footnote:
SC: sub-cortical regions; SM: sensory-motor regions; FC: frontal cortex; and TP: temporal-parietal cortex
ST1: fetal (13 - 26 postconception weeks), ST2: early infancy to late childhood (4 months to 11 years), and ST3: adolescence to adulthood (13 - 23 years)
The bar shown representes the lower 25% and upper 25% of the expression distribution.

No co-expressed genes in brain regions


Section III. Gene Ontology annotation

Molecular function 去的术语 Evidence Neuro keywords PubMed ID
GO:0003682 chromatin binding IEA -
GO:0005515 protein binding 新闻学会 17353931
GO:0031202 RNA splicing factor activity, transesterification mechanism NAS 9585501
Biological process 去的术语 Evidence Neuro keywords PubMed ID
GO:0000398 nuclear mRNA splicing, via spliceosome EXP 12226669
GO:0000398 nuclear mRNA splicing, via spliceosome NAS 9585501
GO:0008380 RNA splicing IEA -
GO:0009952 anterior/posterior pattern formation IEA -
Cellular component 去的术语 Evidence Neuro keywords PubMed ID
GO:0005634 nucleus IEA -
GO:0005681 spliceosome NAS 9585501
GO:0016607 nuclear speck IEA -

Section IV. Protein-protein interaction annotation

Interactors Aliases B Official full name B Experimental Source PubMed ID
ATG12 APG12 | APG12L | FBR93 | HAPG12 ATG12 autophagy related 12 homolog (S. cerevisiae) Affinity Capture-MS BioGRID 17353931
BRF2 BRFU | FLJ11052 | TFIIIB50 BRF2, subunit of RNA polymerase III transcription initiation factor, BRF1-like Affinity Capture-MS BioGRID 17353931
CCNE1 CCNE cyclin E1 Affinity Capture-Western BioGRID 9891079
DDX42 FLJ43179 | RHELP | RNAHP | SF3b125 DEAD (Asp-Glu-Ala-Asp) box polypeptide 42 Affinity Capture-MS
Affinity Capture-Western		 BioGRID 12234937
GSK3B - glycogen synthase kinase 3 beta Affinity Capture-MS BioGRID 17353931
HDAC3 HD3 | RPD3 | RPD3-2 histone deacetylase 3 Affinity Capture-MS BioGRID 17353931
PHF5A INI | MGC1346 | SF3b14b | bK223H9.2 PHD finger protein 5A - HPRD,BioGRID 12234937
PPP1R8 ARD-1 | ARD1 | NIPP-1 | NIPP1 | PRO2047 protein phosphatase 1, regulatory (inhibitor) subunit 8 Affinity Capture-Western
Reconstituted Complex
Two-hybrid		 BioGRID 12105215
PUF60 FIR | FLJ31379 | RoBPI | SIAHBP1 poly-U binding splicing factor 60KDa Affinity Capture-MS BioGRID 17353931
RNPS1 E5.1 | MGC117332 RNA binding protein S1, serine-rich domain Affinity Capture-MS BioGRID 17353931
RNU11 U11 RNA, U11 small nuclear Affinity Capture-MS BioGRID 15146077
RNU12 U12 RNA, U12 small nuclear Affinity Capture-MS BioGRID 15146077
SF3A2 PRP11 | PRPF11 | SAP62 | SF3a66 splicing factor 3a, subunit 2, 66kDa Affinity Capture-MS BioGRID 12234937
SF3B14 CGI-110 | HSPC175 | Ht006 | P14 | SAP14 | SF3B14a splicing factor 3B, 14 kDa subunit - HPRD,BioGRID 11500380
SF3B14 CGI-110 | HSPC175 | Ht006 | P14 | SAP14 | SF3B14a splicing factor 3B, 14 kDa subunit p14 interacts with SF3b155. BIND 11500380
SF3B2 SAP145 | SF3B145 | SF3b1 | SF3b150 splicing factor 3b, subunit 2, 145kDa - HPRD,BioGRID 10490618
SF3B3 KIAA0017 | RSE1 | SAP130 | SF3b130 | STAF130 splicing factor 3b, subunit 3, 130kDa - HPRD 10490618|11406595
|12234937
SF3B3 KIAA0017 | RSE1 | SAP130 | SF3b130 | STAF130 splicing factor 3b, subunit 3, 130kDa Affinity Capture-MS
Affinity Capture-Western		 BioGRID 10490618|12234937
SF3B4 MGC10828 | SAP49 | SF3b49 splicing factor 3b, subunit 4, 49kDa Affinity Capture-MS BioGRID 12234937
SF3B5 MGC3133 | SF3b10 splicing factor 3b, subunit 5, 10kDa Affinity Capture-MS BioGRID 12234937
SMNDC1 SMNR | SPF30 survival motor neuron domain containing 1 Affinity Capture-MS BioGRID 17353931
SNRNP40 40K | FLJ41108 | HPRP8BP | MGC1910 | PRP8BP | PRPF8BP | RP11-490K7.3 | SPF38 | WDR57 small nuclear ribonucleoprotein 40kDa (U5) Affinity Capture-MS BioGRID 17353931
TCERG1 CA150 | MGC133200 | TAF2S transcription elongation regulator 1 - HPRD,BioGRID 15456888
U2AF1 DKFZp313J1712 | FP793 | RN | RNU2AF1 | U2AF35 | U2AFBP U2 small nuclear RNA auxiliary factor 1 SAP155 interacts with U2AF35. BIND 9671485
U2AF2 U2AF65 U2 small nuclear RNA auxiliary factor 2 SAP155 interacts with U2AF65. BIND 9671485
YWHAZ KCIP-1 | MGC111427 | MGC126532 | MGC138156 tyrosine 3-monooxygenase/tryptophan 5-monooxygenase activation protein, zeta polypeptide Affinity Capture-MS BioGRID 17353931


Section V. Pathway annotation

Pathway name Pathway size # SZGR 2.0 genes in pathway Info
KEGG SPLICEOSOME 128 72 All SZGR 2.0 genes in this pathway
REACTOME PROCESSING OF CAPPED INTRON CONTAINING PRE MRNA 140 77 All SZGR 2.0 genes in this pathway
REACTOME MRNA PROCESSING 161 86 All SZGR 2.0 genes in this pathway
REACTOME MRNA SPLICING 111 58 All SZGR 2.0 genes in this pathway
REACTOME MRNA SPLICING MINOR PATHWAY 45 19 All SZGR 2.0 genes in this pathway
SENGUPTA NASOPHARYNGEAL CARCINOMA WITH LMP1 UP 408 247 All SZGR 2.0 genes in this pathway
BASAKI YBX1 TARGETS DN 384 230 All SZGR 2.0 genes in this pathway
OSMAN BLADDER CANCER UP 404 246 All SZGR 2.0 genes in this pathway
GINESTIER BREAST CANCER ZNF217 AMPLIFIED UP 78 48 All SZGR 2.0 genes in this pathway
OSWALD HEMATOPOIETIC STEM CELL IN COLLAGEN GEL UP 233 161 All SZGR 2.0 genes in this pathway
HOEBEKE LYMPHOID STEM CELL UP 95 64 All SZGR 2.0 genes in this pathway
SENESE HDAC1 TARGETS UP 457 269 All SZGR 2.0 genes in this pathway
SENESE HDAC3 TARGETS UP 501 327 All SZGR 2.0 genes in this pathway
RODRIGUES THYROID CARCINOMA ANAPLASTIC UP 722 443 All SZGR 2.0 genes in this pathway
HAHTOLA MYCOSIS FUNGOIDES SKIN UP 177 113 All SZGR 2.0 genes in this pathway
BERENJENO ROCK SIGNALING NOT VIA RHOA DN 48 34 All SZGR 2.0 genes in this pathway
SCHLOSSER SERUM RESPONSE DN 712 443 All SZGR 2.0 genes in this pathway
WOOD EBV EBNA1 TARGETS UP 110 71 All SZGR 2.0 genes in this pathway
SPIELMAN LYMPHOBLAST EUROPEAN VS ASIAN DN 584 395 All SZGR 2.0 genes in this pathway
PUJANA BRCA1 PCC NETWORK 1652 1023 All SZGR 2.0 genes in this pathway
PUJANA ATM PCC NETWORK 1442 892 All SZGR 2.0 genes in this pathway
BENPORATH NANOG TARGETS 988 594 All SZGR 2.0 genes in this pathway
BYSTROEM CORRELATED WITH IL5 DN 64 47 All SZGR 2.0 genes in this pathway
MAHAJAN RESPONSE TO IL1A DN 76 57 All SZGR 2.0 genes in this pathway
STEARMAN LUNG CANCER EARLY VS LATE UP 125 89 All SZGR 2.0 genes in this pathway
MITSIADES RESPONSE TO APLIDIN DN 249 165 All SZGR 2.0 genes in this pathway
MILI PSEUDOPODIA HAPTOTAXIS UP 518 299 All SZGR 2.0 genes in this pathway
CHICAS RB1 TARGETS SENESCENT 572 352 All SZGR 2.0 genes in this pathway
PILON KLF1 TARGETS DN 1972 1213 All SZGR 2.0 genes in this pathway
FEVR CTNNB1 TARGETS DN 553 343 All SZGR 2.0 genes in this pathway
IKEDA MIR1 TARGETS UP 53 39 All SZGR 2.0 genes in this pathway

Section VI. microRNA annotation

miRNA family Target position miRNA ID miRNA seq
UTR start UTR end Match method
miR-204/211 282 289 1A,m8 hsa-miR-204brain UUCCCUUUGUCAUCCUAUGCCU
hsa-miR-211 UUCCCUUUGUCAUCCUUCGCCU
miR-493-5p 315 321 1A hsa-miR-493-5p UUGUACAUGGUAGGCUUUCAUU
miR-543 287 293 m8 hsa-miR-543 AAACAUUCGCGGUGCACUUCU