Gene Page:PATZ1
Summary?
GeneID | 23598 |
Symbol | PATZ1 |
Synonyms | MAZR|PATZ|RIAZ|ZBTB19|ZNF278|ZSG|dJ400N23 |
Description | POZ/BTB and AT hook containing zinc finger 1 |
Reference | MIM:605165|HGNC:HGNC:13071|Ensembl:ENSG00000100105|HPRD:05522|Vega:OTTHUMG00000151254 |
Gene type | protein-coding |
Map location | 22q12.2 |
Pascal p-value | 0.017 |
Sherlock p-value | 0.606 |
Fetal beta | 1.717 |
DMG | 1 (# studies) |
Gene in Data Sources
Gene set name | Method of gene set | Description | Info |
---|---|---|---|
CV:PGCnp | Genome-wide Association Study | GWAS | |
DMG:Wockner_2014 | Genome-wide DNA methylation analysis | This dataset includes 4641 differentially methylated probes corresponding to 2929 unique genes between schizophrenia patients (n=24) and controls (n=24). | 1 |
GSMA_I | Genome scan meta-analysis | Psr: 0.031 |
部分即遗传学和表观遗传学注释
Differentially methylated gene
Probe | Chromosome | Position | Nearest gene | P (dis) | Beta (dis) | FDR (dis) | Study |
---|---|---|---|---|---|---|---|
cg21411490 | 22 | 31739936 | PATZ1 | 3.13E-6 | -0.519 | 0.009 | DMG:Wockner_2014 |
Section II. Transcriptome annotation
General gene expression (GTEx)
![Not available](http://www.tjghsg.com/bioinfo/SZGR/GeneImg/PATZ1_DE_GTEx.png)
Gene expression during devlopment (BrainCloud)
Footnote:
A total of 269 time points ploted, with n=38 fetal samples (x=1:38). Each triangle represents one time point.
Gene expression of temporal and spatial changes (BrainSpan)
Footnote:
SC: sub-cortical regions; SM: sensory-motor regions; FC: frontal cortex; and TP: temporal-parietal cortex
死神:胎儿(13 - 26所示postconception weeks), ST2: early infancy to late childhood (4 months to 11 years), and ST3: adolescence to adulthood (13 - 23 years)
The bar shown representes the lower 25% and upper 25% of the expression distribution.
No co-expressed genes in brain regions
Section III. Gene Ontology annotation
Molecular function | 去的术语 | Evidence | Neuro keywords | PubMed ID |
---|---|---|---|---|
GO:0003677 | DNA binding | NAS | 10949935 | |
GO:0005515 | protein binding | IEA | - | |
GO:0008270 | zinc ion binding | IEA | - | |
GO:0016564 | transcription repressor activity | TAS | 10713105 | |
GO:0016563 | transcription activator activity | IEA | - | |
GO:0046872 | metal ion binding | IEA | - | |
Biological process | 去的术语 | Evidence | Neuro keywords | PubMed ID |
GO:0006355 | regulation of transcription, DNA-dependent | TAS | 10713105 | |
GO:0006350 | transcription | IEA | - | |
Cellular component | 去的术语 | Evidence | Neuro keywords | PubMed ID |
GO:0005622 | intracellular | IEA | - | |
GO:0005634 | nucleus | TAS | 10713105 |
Section V. Pathway annotation
Pathway name | Pathway size | # SZGR 2.0 genes in pathway | Info |
---|---|---|---|
PID AR PATHWAY | 61 | 46 | All SZGR 2.0 genes in this pathway |
HUTTMANN B CLL POOR SURVIVAL UP | 276 | 187 | All SZGR 2.0 genes in this pathway |
DEURIG T CELL PROLYMPHOCYTIC LEUKEMIA DN | 320 | 184 | All SZGR 2.0 genes in this pathway |
CHARAFE BREAST CANCER LUMINAL VS BASAL UP | 380 | 215 | All SZGR 2.0 genes in this pathway |
CHARAFE BREAST CANCER LUMINAL VS MESENCHYMAL UP | 450 | 256 | All SZGR 2.0 genes in this pathway |
WIKMAN ASBESTOS LUNG CANCER DN | 28 | 13 | All SZGR 2.0 genes in this pathway |
雀鳝GALOVIC RESPONSE TO OXIDIZED PHOSPHOLIPIDS YELLOW DN | 23 | 15 | All SZGR 2.0 genes in this pathway |
雀鳝GALOVIC RESPONSE TO OXIDIZED PHOSPHOLIPIDS GREEN DN | 25 | 12 | All SZGR 2.0 genes in this pathway |
雀鳝GALOVIC RESPONSE TO OXIDIZED PHOSPHOLIPIDS BLUE DN | 61 | 35 | All SZGR 2.0 genes in this pathway |
UDAYAKUMAR MED1 TARGETS DN | 240 | 171 | All SZGR 2.0 genes in this pathway |
GRAESSMANN APOPTOSIS BY SERUM DEPRIVATION UP | 552 | 347 | All SZGR 2.0 genes in this pathway |
GRAESSMANN RESPONSE TO MC AND SERUM DEPRIVATION UP | 211 | 136 | All SZGR 2.0 genes in this pathway |
GRAESSMANN APOPTOSIS BY DOXORUBICIN UP | 1142 | 669 | All SZGR 2.0 genes in this pathway |
GRAESSMANN RESPONSE TO MC AND DOXORUBICIN UP | 612 | 367 | All SZGR 2.0 genes in this pathway |
LUI THYROID CANCER CLUSTER 2 | 42 | 31 | All SZGR 2.0 genes in this pathway |
MYLLYKANGAS AMPLIFICATION HOT SPOT 22 | 13 | 9 | All SZGR 2.0 genes in this pathway |
YANG BREAST CANCER ESR1 LASER UP | 34 | 25 | All SZGR 2.0 genes in this pathway |
NUYTTEN NIPP1 TARGETS DN | 848 | 527 | All SZGR 2.0 genes in this pathway |
NUYTTEN EZH2 TARGETS DN | 1024 | 594 | All SZGR 2.0 genes in this pathway |
SHEN SMARCA2 TARGETS DN | 357 | 212 | All SZGR 2.0 genes in this pathway |
ZHAN MULTIPLE MYELOMA CD1 AND CD2 UP | 89 | 51 | All SZGR 2.0 genes in this pathway |
LI WILMS TUMOR VS FETAL KIDNEY 1 UP | 182 | 119 | All SZGR 2.0 genes in this pathway |
IVANOVA HEMATOPOIESIS EARLY PROGENITOR | 532 | 309 | All SZGR 2.0 genes in this pathway |
JIANG VHL TARGETS | 138 | 91 | All SZGR 2.0 genes in this pathway |
BLALOCK ALZHEIMERS DISEASE UP | 1691 | 1088 | All SZGR 2.0 genes in this pathway |
DAZARD RESPONSE TO UV SCC DN | 123 | 86 | All SZGR 2.0 genes in this pathway |
LI CYTIDINE ANALOGS CYCTOTOXICITY | 15 | 8 | All SZGR 2.0 genes in this pathway |
STEIN ESRRA TARGETS DN | 105 | 63 | All SZGR 2.0 genes in this pathway |
HELLER HDAC TARGETS DN | 292 | 189 | All SZGR 2.0 genes in this pathway |
MARTINEZ RB1 TARGETS DN | 543 | 317 | All SZGR 2.0 genes in this pathway |
MARTINEZ TP53 TARGETS DN | 593 | 372 | All SZGR 2.0 genes in this pathway |
MARTINEZ RB1 AND TP53 TARGETS DN | 591 | 366 | All SZGR 2.0 genes in this pathway |
WALLACE PROSTATE CANCER RACE DN | 88 | 42 | All SZGR 2.0 genes in this pathway |
ZHANG BREAST CANCER PROGENITORS UP | 425 | 253 | All SZGR 2.0 genes in this pathway |
WEST ADRENOCORTICAL TUMOR DN | 546 | 362 | All SZGR 2.0 genes in this pathway |
GRESHOCK CANCER COPY NUMBER UP | 323 | 240 | All SZGR 2.0 genes in this pathway |
RAY TARGETS OF P210 BCR ABL FUSION DN | 16 | 11 | All SZGR 2.0 genes in this pathway |
AGUIRRE PANCREATIC CANCER COPY NUMBER DN | 238 | 145 | All SZGR 2.0 genes in this pathway |
STEIN ESRRA TARGETS | 535 | 325 | All SZGR 2.0 genes in this pathway |
BROWNE HCMV INFECTION 4HR DN | 254 | 158 | All SZGR 2.0 genes in this pathway |
PILON KLF1 TARGETS DN | 1972 | 1213 | All SZGR 2.0 genes in this pathway |
Section VI. microRNA annotation
miRNA family | Target position | miRNA ID | miRNA seq | ||
---|---|---|---|---|---|
UTR start | UTR end | Match method | |||
miR-134 | 796 | 803 | 1A,m8 | hsa-miR-134brain | UGUGACUGGUUGACCAGAGGG |
miR-142-3p | 241 | 248 | 1A,m8 | hsa-miR-142-3p | UGUAGUGUUUCCUACUUUAUGGA |
miR-153 | 890 | 896 | 1A | hsa-miR-153 | UUGCAUAGUCACAAAAGUGA |
miR-200bc/429 | 814 | 820 | 1A | hsa-miR-200b | UAAUACUGCCUGGUAAUGAUGAC |
hsa-miR-200c | UAAUACUGCCGGGUAAUGAUGG | ||||
hsa-miR-429 | UAAUACUGUCUGGUAAAACCGU | ||||
miR-23 | 1037 | 1043 | 1A | hsa-miR-23abrain | AUCACAUUGCCAGGGAUUUCC |
hsa-miR-23bbrain | AUCACAUUGCCAGGGAUUACC | ||||
miR-27 | 53 | 59 | 1A | hsa-miR-27abrain | UUCACAGUGGCUAAGUUCCGC |
hsa-miR-27bbrain | UUCACAGUGGCUAAGUUCUGC | ||||
miR-299-5p | 788 | 794 | m8 | hsa-miR-299-5p | UGGUUUACCGUCCCACAUACAU |
miR-30-3p | 754 | 760 | m8 | hsa-miR-30a-3p | CUUUCAGUCGGAUGUUUGCAGC |
hsa-miR-30e-3p | CUUUCAGUCGGAUGUUUACAGC | ||||
miR-361 | 188 | 194 | m8 | hsa-miR-361brain | UUAUCAGAAUCUCCAGGGGUAC |
miR-383 | 1048 | 1055 | 1A,m8 | hsa-miR-383brain | AGAUCAGAAGGUGAUUGUGGCU |
miR-448 | 890 | 896 | 1A | hsa-miR-448 | UUGCAUAUGUAGGAUGUCCCAU |
miR-490 | 1021 | 1027 | m8 | hsa-miR-490 | CAACCUGGAGGACUCCAUGCUG |
miR-491 | 14 | 20 | m8 | hsa-miR-491brain | AGUGGGGAACCCUUCCAUGAGGA |
miR-544 | 234 | 240 | 1A | hsa-miR-544 | AUUCUGCAUUUUUAGCAAGU |
- SZ: miRNAs which differentially expressed in brain cortex of schizophrenia patients comparing with control samples using microarray. Clickhereto see the list of SZ related miRNAs.
- Brain: miRNAs which are expressed in brain based on miRNA microarray expression studies. Clickhereto see the list of brain related miRNAs.