Gene Page:MTCH1
Summary?
GeneID | 23787 |
Symbol | MTCH1 |
Synonyms | CGI-64|PIG60|PSAP|SLC25A49 |
Description | mitochondrial carrier 1 |
Reference | MIM:610449|HGNC:HGNC:17586|Ensembl:ENSG00000137409|HPRD:14787|Vega:OTTHUMG00000014614 |
Gene type | protein-coding |
Map location | 6p21.2 |
Pascal p-value | 0.304 |
Sherlock p-value | 0.335 |
Fetal beta | -1.887 |
DMG | 1 (# studies) |
eGene | Hypothalamus Myers' cis & trans 元 |
Support | G2Cdb.human_BAYES-COLLINS-HUMAN-PSD-FULL G2Cdb.human_mitochondria |
Gene in Data Sources
Gene set name | Method of gene set | Description | Info |
---|---|---|---|
CV:PGCnp | Genome-wide Association Study | GWAS | |
DMG:Wockner_2014 | Genome-wide DNA methylation analysis | This dataset includes 4641 differentially methylated probes corresponding to 2929 unique genes between schizophrenia patients (n=24) and controls (n=24). | 1 |
GSMA_I | Genome scan meta-analysis | Psr: 0.033 | |
GSMA_IIE | Genome scan meta-analysis (European-ancestry samples) | Psr: 0.04433 | |
GO_Annotation | Mapping neuro-related keywords to Gene Ontology annotations | Hits with neuro-related keywords: 1 |
Section I. Genetics and epigenetics annotation
Differentially methylated gene
Probe | Chromosome | Position | Nearest gene | P (dis) | Beta (dis) | FDR (dis) | Study |
---|---|---|---|---|---|---|---|
cg12592908 | 6 | 36954170 | MTCH1 | 4.132E-4 | -0.349 | 0.044 | DMG:Wockner_2014 |
eQTL annotation
SNP ID | Chromosome | Position | eGene | Gene Entrez ID | pvalue | qvalue | TSS distance | eQTL type |
---|---|---|---|---|---|---|---|---|
rs9366917 | chr6 | 36790665 | MTCH1 | 23787 | 0.14 | cis |
Section II. Transcriptome annotation
General gene expression (GTEx)
Gene expression during devlopment (BrainCloud)
Footnote:
A total of 269 time points ploted, with n=38 fetal samples (x=1:38). Each triangle represents one time point.
Gene expression of temporal and spatial changes (BrainSpan)
Footnote:
SC: sub-cortical regions; SM: sensory-motor regions; FC: frontal cortex; and TP: temporal-parietal cortex
死神:胎儿(13 - 26 postconception weeks), ST2: early infancy to late childhood (4 months to 11 years), and ST3: adolescence to adulthood (13 - 23 years)
The bar shown representes the lower 25% and upper 25% of the expression distribution.
No co-expressed genes in brain regions
Section III. Gene Ontology annotation
Molecular function | 去的术语 | Evidence | Neuro keywords | PubMed ID |
---|---|---|---|---|
GO:0005488 | binding | IEA | - | |
GO:0005515 | protein binding | 新闻学会 | 12377771 | |
GO:0005515 | protein binding | ISS | - | |
GO:0030165 | PDZ domain binding | NAS | 10551805 | |
Biological process | 去的术语 | Evidence | Neuro keywords | PubMed ID |
GO:0045161 | neuronal ion channel clustering | NAS | neuron (GO term level: 11) | 10551805 |
GO:0009966 | regulation of signal transduction | NAS | 10551805 | |
GO:0006810 | transport | IEA | - | |
GO:0006919 | caspase activation | IMP | 12377771 | |
GO:0006919 | caspase activation | ISS | - | |
GO:0043065 | positive regulation of apoptosis | IEP | 12377771 | |
GO:0043065 | positive regulation of apoptosis | ISS | - | |
Cellular component | 去的术语 | Evidence | Neuro keywords | PubMed ID |
GO:0005622 | intracellular | NAS | 10551805 | |
GO:0005739 | mitochondrion | IMP | 12377771 | |
GO:0005739 | mitochondrion | ISS | - | |
GO:0005743 | mitochondrial inner membrane | IEA | - | |
GO:0016020 | membrane | IEA | - | |
GO:0016021 | integral to membrane | IEA | - |
Section V. Pathway annotation
Pathway name | Pathway size | # SZGR 2.0 genes in pathway | Info |
---|---|---|---|
OSMAN BLADDER CANCER DN | 406 | 230 | All SZGR 2.0 genes in this pathway |
TIEN INTESTINE PROBIOTICS 24HR UP | 557 | 331 | All SZGR 2.0 genes in this pathway |
ALCALA APOPTOSIS | 88 | 60 | All SZGR 2.0 genes in this pathway |
SCHAEFFER PROSTATE DEVELOPMENT 12HR DN | 57 | 45 | All SZGR 2.0 genes in this pathway |
NING CHRONIC OBSTRUCTIVE PULMONARY DISEASE UP | 157 | 105 | All SZGR 2.0 genes in this pathway |
MATSUDA NATURAL KILLER DIFFERENTIATION | 475 | 313 | All SZGR 2.0 genes in this pathway |
IVANOVA HEMATOPOIESIS STEM CELL AND PROGENITOR | 681 | 420 | All SZGR 2.0 genes in this pathway |
LEIN LOCALIZED TO PROXIMAL DENDRITES | 37 | 26 | All SZGR 2.0 genes in this pathway |
STEARMAN LUNG CANCER EARLY VS LATE UP | 125 | 89 | All SZGR 2.0 genes in this pathway |
MOOTHA HUMAN MITODB 6 2002 | 429 | 260 | All SZGR 2.0 genes in this pathway |
MOOTHA MITOCHONDRIA | 447 | 277 | All SZGR 2.0 genes in this pathway |
BOYLAN MULTIPLE MYELOMA D CLUSTER DN | 40 | 26 | All SZGR 2.0 genes in this pathway |
BOYLAN MULTIPLE MYELOMA D DN | 78 | 34 | All SZGR 2.0 genes in this pathway |
BRUINS UVC RESPONSE LATE | 1137 | 655 | All SZGR 2.0 genes in this pathway |
Section VI. microRNA annotation
miRNA family | Target position | miRNA ID | miRNA seq | ||
---|---|---|---|---|---|
UTR start | UTR end | Match method | |||
miR-330 | 416 | 422 | m8 | hsa-miR-330brain | GCAAAGCACACGGCCUGCAGAGA |
- SZ: miRNAs which differentially expressed in brain cortex of schizophrenia patients comparing with control samples using microarray. Clickhereto see the list of SZ related miRNAs.
- Brain: miRNAs which are expressed in brain based on miRNA microarray expression studies. Clickhereto see the list of brain related miRNAs.