Gene Page:ALK

Summary?
GeneID 238
Symbol ALK
Synonyms CD246|NBLST3
Description anaplastic lymphoma receptor tyrosine kinase
Reference MIM:105590|HGNC:HGNC:427|Ensembl:ENSG00000171094|HPRD:00104|Vega:OTTHUMG00000152034
Gene type protein-coding
Map location 2p23
Pascal p-value 0.015
Sherlock p-value 0.825
Fetal beta -0.495

Gene in Data Sources
Gene set name Method of gene set Description Info
CV:GWASdb Genome-wide Association Studies GWASdb records for schizophrenia
CV:PGCnp Genome-wide Association Study GWAS
PMID:cooccur High-throughput literature-search Systematic search in PubMed for genes co-occurring with SCZ keywords. A total of 3027 genes were included.
Association A combined odds ratio method (Sun et al. 2008), association studies 1 Link to SZGene
Literature High-throughput literature-search Co-occurance with Schizophrenia keywords: schizophrenia,schizophrenic,schizophrenics,schizophrenias Click to show details
GO_Annotation Mapping neuro-related keywords to Gene Ontology annotations Hits with neuro-related keywords: 3

Section I. Genetics and epigenetics annotation


Section II. Transcriptome annotation

General gene expression (GTEx)

Not available

Gene expression during devlopment (BrainCloud)

Footnote:
A total of 269 time points ploted, with n=38 fetal samples (x=1:38). Each triangle represents one time point.

Gene expression of temporal and spatial changes (BrainSpan)

Footnote:
SC: sub-cortical regions; SM: sensory-motor regions; FC: frontal cortex; and TP: temporal-parietal cortex
ST1: fetal (13 - 26 postconception weeks), ST2: early infancy to late childhood (4 months to 11 years), and ST3: adolescence to adulthood (13 - 23 years)
The bar shown representes the lower 25% and upper 25% of the expression distribution.

Top co-expressed genes in brain regions

Top 10 positively co-expressed genes
Gene Pearson's Correlation Spearman's Correlation
TBXAS1 0.87 0.83
C3AR1 0.86 0.80
P2RY12 0.81 0.79
C1QC 0.81 0.83
LAPTM5 0.80 0.84
ADORA3 0.80 0.82
RNASE6 0.78 0.82
CD53 0.77 0.80
C3 0.77 0.82
GPR34 0.77 0.80
Top 10 negatively co-expressed genes
Gene Pearson's Correlation Spearman's Correlation
SH3BP2 -0.34 -0.42
ZNF814 -0.34 -0.40
ZNF418 -0.34 -0.31
KIAA1949 -0.33 -0.30
VAV2 -0.33 -0.27
GJC1 -0.33 -0.32
AC004017.1 -0.33 -0.25
AL033532.1 -0.33 -0.26
AC010522.1 -0.33 -0.39
UPF3A -0.33 -0.39

Section III. Gene Ontology annotation

Molecular function GO term Evidence Neuro keywords PubMed ID
GO:0004714 跨膜受体蛋白tyrosine kinase activity IDA neurite (GO term level: 8) 9174053
GO:0000166 nucleotide binding IEA -
GO:0004872 receptor activity IEA -
GO:0004716 receptor signaling protein tyrosine kinase activity TAS 9053841
GO:0005515 protein binding IEA -
GO:0005524 ATP binding IEA -
GO:0016740 transferase activity IEA -
Biological process GO term Evidence Neuro keywords PubMed ID
GO:0007420 brain development TAS Brain (GO term level: 7) 9053841
GO:0007399 nervous system development IMP neurite (GO term level: 5) 11121404
GO:0007169 跨膜受体蛋白tyrosine kinase signaling pathway IEA -
GO:0006468 protein amino acid phosphorylation IEA -
GO:0006487 protein amino acid N-linked glycosylation IMP 9174053
Cellular component GO term Evidence Neuro keywords PubMed ID
GO:0016020 membrane IEA -
GO:0005887 integral to plasma membrane TAS 9053841

Section V. Pathway annotation

Pathway name Pathway size # SZGR 2.0 genes in pathway Info
ONKEN UVEAL MELANOMA UP 783 507 All SZGR 2.0 genes in this pathway
DAVICIONI PAX FOXO1 SIGNATURE IN ARMS UP 59 38 All SZGR 2.0 genes in this pathway
DAVICIONI MOLECULAR ARMS VS ERMS UP 332 228 All SZGR 2.0 genes in this pathway
DAVICIONI TARGETS OF PAX FOXO1 FUSIONS UP 255 177 All SZGR 2.0 genes in this pathway
DAVICIONI RHABDOMYOSARCOMA PAX FOXO1 FUSION UP 64 37 All SZGR 2.0 genes in this pathway
HOOI ST7 TARGETS DN 123 78 All SZGR 2.0 genes in this pathway
TAKEDA TARGETS OF NUP98 HOXA9 FUSION 16D DN 143 83 All SZGR 2.0 genes in this pathway
MULLIGHAN NPM1 MUTATED SIGNATURE 1 UP 276 165 All SZGR 2.0 genes in this pathway
MULLIGHAN NPM1 MUTATED SIGNATURE 2 UP 139 83 All SZGR 2.0 genes in this pathway
MULLIGHAN NPM1 SIGNATURE 3 UP 341 197 All SZGR 2.0 genes in this pathway
LASTOWSKA COAMPLIFIED WITH MYCN 43 29 All SZGR 2.0 genes in this pathway
WEI MYCN TARGETS WITH E BOX 795 478 All SZGR 2.0 genes in this pathway
CHEN NEUROBLASTOMA COPY NUMBER GAINS 50 35 All SZGR 2.0 genes in this pathway
BYSTRYKH HEMATOPOIESIS STEM CELL QTL TRANS 882 572 All SZGR 2.0 genes in this pathway
RIGGI EWING SARCOMA PROGENITOR UP 430 288 All SZGR 2.0 genes in this pathway
FIRESTEIN PROLIFERATION 175 125 All SZGR 2.0 genes in this pathway
GRESHOCK CANCER COPY NUMBER UP 323 240 All SZGR 2.0 genes in this pathway
TAVAZOIE METASTASIS 108 68 All SZGR 2.0 genes in this pathway
MEISSNER NPC HCP WITH H3K4ME2 AND H3K27ME3 349 234 All SZGR 2.0 genes in this pathway
MIKKELSEN NPC HCP WITH H3K27ME3 341 243 All SZGR 2.0 genes in this pathway
MIKKELSEN MEF HCP WITH H3K27ME3 590 403 All SZGR 2.0 genes in this pathway

Section VI. microRNA annotation

miRNA family Target position miRNA ID miRNA seq
UTR start UTR end Match method
miR-96 107 113 m8 hsa-miR-96brain UUUGGCACUAGCACAUUUUUGC