Gene Page:ZNF318

Summary?
GeneID 24149
Symbol ZNF318
Synonyms HRIHFB2436|TZF|ZFP318
Description zinc finger protein 318
Reference HGNC:HGNC:13578|Ensembl:ENSG00000171467|HPRD:11707|Vega:OTTHUMG00000014732
Gene type protein-coding
Map location 6p21.1
Pascal p-value 1.125E-6
Sherlock p-value 0.287
Fetal beta 0.447
DMG 2 (# studies)
eGene Myers' cis & trans

Gene in Data Sources
Gene set name Method of gene set Description Info
CV:GWASdb Genome-wide Association Studies GWASdb records for schizophrenia
CV:PGCnp Genome-wide Association Study GWAS
DMG:Nishioka_2013 Genome-wide DNA methylation analysis The authors investigated the methylation profiles of DNA in peripheral blood cells from 18 patients with first-episode schizophrenia (FESZ) and from 15 normal controls. 2
DMG:Wockner_2014 Genome-wide DNA methylation analysis This dataset includes 4641 differentially methylated probes corresponding to 2929 unique genes between schizophrenia patients (n=24) and controls (n=24). 2
GSMA_IIE Genome scan meta-analysis (European-ancestry samples) Psr: 0.04433

Section I. Genetics and epigenetics annotation

@Differentially methylated gene

Probe Chromosome Position Nearest gene P (dis) Beta (dis) FDR (dis) Study
cg11037064 6 43336719 ZNF318 4.73E-5 -0.412 0.021 DMG:Wockner_2014
cg11928635 6 43337708 ZNF318 -0.031 0.29 DMG:Nishioka_2013

@eQTL annotation

SNP ID Chromosome Position eGene Gene Entrez ID pvalue qvalue TSS distance eQTL type
rs12477018 chr2 10519846 ZNF318 24149 0.17 trans
rs6954503 chr7 45155967 ZNF318 24149 0.17 trans
rs3803498 chr15 63053678 ZNF318 24149 0.03 trans
rs3803497 chr15 63053857 ZNF318 24149 0.05 trans
rs3825972 chr15 63054068 ZNF318 24149 0.02 trans

Section II. Transcriptome annotation

General gene expression (GTEx)

Not available

Gene expression during devlopment (BrainCloud)

Footnote:
A total of 269 time points ploted, with n=38 fetal samples (x=1:38). Each triangle represents one time point.

Gene expression of temporal and spatial changes (BrainSpan)

Footnote:
SC: sub-cortical regions; SM: sensory-motor regions; FC: frontal cortex; and TP: temporal-parietal cortex
ST1: fetal (13 - 26 postconception weeks), ST2: early infancy to late childhood (4 months to 11 years), and ST3: adolescence to adulthood (13 - 23 years)
The bar shown representes the lower 25% and upper 25% of the expression distribution.

No co-expressed genes in brain regions


Section III. Gene Ontology annotation

Molecular function GO term Evidence Neuro keywords PubMed ID
GO:0003676 nucleic acid binding IEA -
GO:0008270 zinc ion binding IEA -
GO:0046872 metal ion binding IEA -
Biological process GO term Evidence Neuro keywords PubMed ID
GO:0006355 regulation of transcription, DNA-dependent IEA -
GO:0006350 transcription IEA -
GO:0007126 meiosis IEA -
Cellular component GO term Evidence Neuro keywords PubMed ID
GO:0005622 intracellular IEA -
GO:0005634 nucleus IEA -

Section V. Pathway annotation

Pathway name Pathway size # SZGR 2.0 genes in pathway Info
PID AR PATHWAY 61 46 All SZGR 2.0 genes in this pathway
LIU SOX4 TARGETS UP 137 94 All SZGR 2.0 genes in this pathway
GAZDA DIAMOND BLACKFAN ANEMIA ERYTHROID DN 493 298 All SZGR 2.0 genes in this pathway
GARY CD5 TARGETS UP 473 314 All SZGR 2.0 genes in this pathway
LIU CMYB TARGETS UP 165 106 All SZGR 2.0 genes in this pathway
LIU VMYB TARGETS UP 127 78 All SZGR 2.0 genes in this pathway
BORCZUK MALIGNANT MESOTHELIOMA UP 305 185 All SZGR 2.0 genes in this pathway
GINESTIER BREAST CANCER 20Q13 AMPLIFICATION DN 180 101 All SZGR 2.0 genes in this pathway
MULLIGHAN MLL SIGNATURE 1 UP 380 236 All SZGR 2.0 genes in this pathway
MULLIGHAN MLL SIGNATURE 2 UP 418 263 All SZGR 2.0 genes in this pathway
BIDUS METASTASIS UP 214 134 All SZGR 2.0 genes in this pathway
GRAESSMANN APOPTOSIS BY DOXORUBICIN DN 1781 1082 All SZGR 2.0 genes in this pathway
SPIELMAN LYMPHOBLAST EUROPEAN VS ASIAN DN 584 395 All SZGR 2.0 genes in this pathway
PUJANA BRCA1 PCC NETWORK 1652 1023 All SZGR 2.0 genes in this pathway
PUJANA ATM PCC NETWORK 1442 892 All SZGR 2.0 genes in this pathway
SCHAEFFER PROSTATE DEVELOPMENT 6HR UP 176 115 All SZGR 2.0 genes in this pathway
MA PITUITARY FETAL VS ADULT DN 19 17 All SZGR 2.0 genes in this pathway
DAZARD RESPONSE TO UV NHEK DN 318 220 All SZGR 2.0 genes in this pathway
QI PLASMACYTOMA UP 259 185 All SZGR 2.0 genes in this pathway
YAGI AML WITH INV 16 TRANSLOCATION 422 277 All SZGR 2.0 genes in this pathway
FORTSCHEGGER PHF8 TARGETS DN 784 464 All SZGR 2.0 genes in this pathway
HOLLEMAN天冬酰胺酶RESISTANCE B ALL DN 15 10 All SZGR 2.0 genes in this pathway
HOLLEMAN PREDNISOLONE RESISTANCE ALL UP 19 15 All SZGR 2.0 genes in this pathway
HOLLEMAN天冬酰胺酶RESISTANCE ALL DN 25 14 All SZGR 2.0 genes in this pathway
SMIRNOV RESPONSE TO IR 6HR DN 114 69 All SZGR 2.0 genes in this pathway

Section VI. microRNA annotation

miRNA family Target position miRNA ID miRNA seq
UTR start UTR end Match method
let-7/98 937 943 m8 hsa-let-7abrain UGAGGUAGUAGGUUGUAUAGUU
hsa-let-7bbrain UGAGGUAGUAGGUUGUGUGGUU
hsa-let-7cbrain UGAGGUAGUAGGUUGUAUGGUU
hsa-let-7dbrain AGAGGUAGUAGGUUGCAUAGU
hsa-let-7ebrain UGAGGUAGGAGGUUGUAUAGU
hsa-let-7fbrain UGAGGUAGUAGAUUGUAUAGUU
hsa-miR-98brain UGAGGUAGUAAGUUGUAUUGUU
hsa-let-7gSZ UGAGGUAGUAGUUUGUACAGU
hsa-let-7ibrain UGAGGUAGUAGUUUGUGCUGU
miR-323 1051 1057 m8 hsa-miR-323brain GCACAUUACACGGUCGACCUCU
miR-330 339 345 1A hsa-miR-330brain GCAAAGCACACGGCCUGCAGAGA
miR-488 87 93 1A hsa-miR-488 CCCAGAUAAUGGCACUCUCAA