Gene Page:FRZB

Summary?
GeneID 2487
Symbol FRZB
Synonyms FRE|FRITZ|FRP-3|FRZB-1|FRZB-PEN|FRZB1|FZRB|OS1|SFRP3|SRFP3|hFIZ
Description frizzled-related protein
Reference MIM:605083|HGNC:HGNC:3959|Ensembl:ENSG00000162998|HPRD:07282|Vega:OTTHUMG00000132597
Gene type protein-coding
Map location 2q32.1
Pascal p-value 0.071
Sherlock p-value 0.541
Fetal beta -0.587
eGene Myers' cis & trans

Gene in Data Sources
Gene set name Method of gene set Description Info
CV:GWASdb Genome-wide Association Studies GWASdb records for schizophrenia
CV:PGCnp Genome-wide Association Study GWAS
Expression Meta-analysis of gene expression Pvalue: 1.382

Section I. Genetics and epigenetics annotation

@eQTL annotation

SNP ID Chromosome Position eGene Gene Entrez ID pvalue qvalue TSS distance eQTL type
rs11706314 chr3 45309716 FRZB 2487 0.03 trans
rs11706394 chr3 45309907 FRZB 2487 0.06 trans
rs2976809 chr3 125451738 FRZB 2487 0.05 trans
rs6449169 0 FRZB 2487 0.19 trans
rs13136254 chr4 184824883 FRZB 2487 0.15 trans
rs9313797 chr5 158465457 FRZB 2487 0.18 trans
rs17056474 chr5 158468105 FRZB 2487 0.18 trans
rs6455226 chr6 67930295 FRZB 2487 0.12 trans
rs2199402 chr8 9201002 FRZB 2487 0.04 trans
rs7841407 chr8 9243427 FRZB 2487 0.01 trans
rs17134872 chr11 76139845 FRZB 2487 0.15 trans
rs11236774 chr11 76234952 FRZB 2487 0.15 trans
rs4942043 chr13 41978218 FRZB 2487 0.14 trans
rs4402447 chr13 41984741 FRZB 2487 0.19 trans
rs9529974 chr13 72821935 FRZB 2487 0.13 trans
rs17720221 chr13 75182377 FRZB 2487 0.06 trans
rs6095741 chr20 48666589 FRZB 2487 0.11 trans
rs5991662 chrX 43335796 FRZB 2487 0.03 trans

Section II. Transcriptome annotation

General gene expression (GTEx)

Not available

Gene expression during devlopment (BrainCloud)

Footnote:
A total of 269 time points ploted, with n=38 fetal samples (x=1:38). Each triangle represents one time point.

Gene expression of temporal and spatial changes (BrainSpan)

Footnote:
SC: sub-cortical regions; SM: sensory-motor regions; FC: frontal cortex; and TP: temporal-parietal cortex
死神:胎儿(13 - 26 postconception weeks), ST2: early infancy to late childhood (4 months to 11 years), and ST3: adolescence to adulthood (13 - 23 years)
The bar shown representes the lower 25% and upper 25% of the expression distribution.

No co-expressed genes in brain regions


Section III. Gene Ontology annotation

Molecular function 去的术语 Evidence Neuro keywords PubMed ID
GO:0017147 Wnt-protein binding ISS -
Biological process 去的术语 Evidence Neuro keywords PubMed ID
GO:0001501 skeletal system development TAS 8824257
GO:0007275 multicellular organismal development IEA -
GO:0030178 negative regulation of Wnt receptor signaling pathway ISS -
GO:0030154 cell differentiation IEA -
Cellular component 去的术语 Evidence Neuro keywords PubMed ID
GO:0005576 extracellular region TAS 9096311
GO:0016020 membrane TAS 8824257

Section V. Pathway annotation

Pathway name Pathway size # SZGR 2.0 genes in pathway Info
WNT SIGNALING 89 71 All SZGR 2.0 genes in this pathway
WINTER HYPOXIA DN 52 30 All SZGR 2.0 genes in this pathway
BORCZUK MALIGNANT MESOTHELIOMA DN 104 59 All SZGR 2.0 genes in this pathway
PEREZ TP53 TARGETS 1174 695 All SZGR 2.0 genes in this pathway
LIEN BREAST CARCINOMA METAPLASTIC VS DUCTAL DN 114 58 All SZGR 2.0 genes in this pathway
LI WILMS TUMOR VS FETAL KIDNEY 2 DN 51 42 All SZGR 2.0 genes in this pathway
HATADA METHYLATED IN LUNG CANCER UP 390 236 All SZGR 2.0 genes in this pathway
GROSS HYPOXIA VIA ELK3 UP 209 139 All SZGR 2.0 genes in this pathway
GROSS HYPOXIA VIA HIF1A UP 77 49 All SZGR 2.0 genes in this pathway
GROSS HYPOXIA VIA ELK3 AND HIF1A DN 103 71 All SZGR 2.0 genes in this pathway
NUYTTEN EZH2 TARGETS DN 1024 594 All SZGR 2.0 genes in this pathway
RICKMAN TUMOR DIFFERENTIATED WELL VS POORLY UP 236 139 All SZGR 2.0 genes in this pathway
RICKMAN METASTASIS UP 344 180 All SZGR 2.0 genes in this pathway
RICKMAN HEAD AND NECK CANCER A 100 63 All SZGR 2.0 genes in this pathway
BENPORATH CYCLING GENES 648 385 All SZGR 2.0 genes in this pathway
SAKAI CHRONIC HEPATITIS VS LIVER CANCER DN 36 24 All SZGR 2.0 genes in this pathway
TARTE PLASMA CELL VS PLASMABLAST UP 398 262 All SZGR 2.0 genes in this pathway
ZHAN MULTIPLE MYELOMA HP UP 49 26 All SZGR 2.0 genes in this pathway
KAYO AGING MUSCLE UP 244 165 All SZGR 2.0 genes in this pathway
MACLACHLAN BRCA1 TARGETS DN 16 12 All SZGR 2.0 genes in this pathway
SANSOM WNT PATHWAY REQUIRE MYC 58 43 All SZGR 2.0 genes in this pathway
KYNG DNA DAMAGE BY GAMMA RADIATION 81 59 All SZGR 2.0 genes in this pathway
KYNG DNA DAMAGE UP 226 164 All SZGR 2.0 genes in this pathway
RIGGI EWING SARCOMA PROGENITOR UP 430 288 All SZGR 2.0 genes in this pathway
ACEVEDO LIVER CANCER UP 973 570 All SZGR 2.0 genes in this pathway
乳腺癌萧述三腔的DN 564 326 All SZGR 2.0 genes in this pathway
SMID BREAST CANCER NORMAL LIKE UP 476 285 All SZGR 2.0 genes in this pathway
BOQUEST STEM CELL CULTURED VS FRESH UP 425 298 All SZGR 2.0 genes in this pathway
YAUCH HEDGEHOG SIGNALING PARACRINE UP 149 85 All SZGR 2.0 genes in this pathway
VART KSHV INFECTION ANGIOGENIC MARKERS UP 165 118 All SZGR 2.0 genes in this pathway
VART KSHV INFECTION ANGIOGENIC MARKERS DN 138 92 All SZGR 2.0 genes in this pathway
DAVIES MULTIPLE MYELOMA VS MGUS UP 13 10 All SZGR 2.0 genes in this pathway
FINAK BREAST CANCER SDPP SIGNATURE 26 11 All SZGR 2.0 genes in this pathway
CHEN METABOLIC SYNDROM NETWORK 1210 725 All SZGR 2.0 genes in this pathway
MEISSNER BRAIN HCP WITH H3K4ME3 AND H3K27ME3 1069 729 All SZGR 2.0 genes in this pathway
CROONQUIST IL6 DEPRIVATION DN 98 69 All SZGR 2.0 genes in this pathway
ZHAN V1 LATE DIFFERENTIATION GENES DN 15 13 All SZGR 2.0 genes in this pathway
POOLA INVASIVE BREAST CANCER DN 134 83 All SZGR 2.0 genes in this pathway
HOSHIDA LIVER CANCER LATE RECURRENCE UP 62 42 All SZGR 2.0 genes in this pathway
FONTAINE THYROID TUMOR UNCERTAIN MALIGNANCY DN 26 14 All SZGR 2.0 genes in this pathway
FONTAINE PAPILLARY THYROID CARCINOMA DN 80 53 All SZGR 2.0 genes in this pathway
WHITFIELD CELL CYCLE G2 M 216 124 All SZGR 2.0 genes in this pathway
CHICAS RB1 TARGETS CONFLUENT 567 365 All SZGR 2.0 genes in this pathway
WANG MLL TARGETS 289 188 All SZGR 2.0 genes in this pathway
ROLEF GLIS3 TARGETS 37 29 All SZGR 2.0 genes in this pathway
ALFANO MYC TARGETS 239 156 All SZGR 2.0 genes in this pathway
NABA SECRETED FACTORS 344 197 All SZGR 2.0 genes in this pathway
NABA MATRISOME ASSOCIATED 753 411 All SZGR 2.0 genes in this pathway
NABA MATRISOME 1028 559 All SZGR 2.0 genes in this pathway

Section VI. microRNA annotation

miRNA family Target position miRNA ID miRNA seq
UTR start UTR end Match method
miR-338 55 61 1A hsa-miR-338brain UCCAGCAUCAGUGAUUUUGUUGA