Gene Page:KCTD13

Summary?
GeneID 253980
Symbol KCTD13
Synonyms BACURD1|FKSG86|PDIP1|POLDIP1|hBACURD1
Description potassium channel tetramerization domain containing 13
Reference MIM:608947|HGNC:HGNC:22234|Ensembl:ENSG00000174943|HPRD:12339|Vega:OTTHUMG00000132120
Gene type protein-coding
Map location 16p11.2
Pascal p-value 1.261E-9
Sherlock p-value 0.277
Fetal beta 0.219
eGene Myers' cis & trans

Gene in Data Sources
Gene set name Method of gene set Description Info
CNV:YES Copy number variation studies Manual curation
CV:GWAScat Genome-wide Association Studies This data set includes 560 SNPs associated with schizophrenia. A total of 486 genes were mapped to these SNPs within 50kb.
CV:PGC128 Genome-wide Association Study A multi-stage schizophrenia GWAS of up to 36,989 cases and 113,075 controls. Reported by the Schizophrenia Working Group of PGC. 128 independent associations spanning 108 loci
CV:PGCnp Genome-wide Association Study GWAS
PMID:cooccur High-throughput literature-search 系统搜索PubMed的genes co-occurring with SCZ keywords. A total of 3027 genes were included.
GSMA_IIE Genome scan meta-analysis (European-ancestry samples) Psr: 0.01775
Literature High-throughput literature-search Co-occurance with Schizophrenia keywords: schizophrenia,schizophrenias Click to show details

Section I. Genetics and epigenetics annotation

@CV:PGC128

SNP ID Chromosome Position Allele P Function Gene Up/Down Distance
rs12691307 chr16 29939877 AG 1.298E-10 intergenic KCTD13,TMEM219 dist=2324;dist=33474

@eQTL annotation

SNP ID Chromosome Position eGene Gene Entrez ID pvalue qvalue TSS distance eQTL type
rs9968605 chr5 124299675 KCTD13 253980 0.15 trans

Section II. Transcriptome annotation

General gene expression (GTEx)

Not available

Gene expression during devlopment (BrainCloud)

Footnote:
A total of 269 time points ploted, with n=38 fetal samples (x=1:38). Each triangle represents one time point.

Gene expression of temporal and spatial changes (BrainSpan)

Footnote:
SC: sub-cortical regions; SM: sensory-motor regions; FC: frontal cortex; and TP: temporal-parietal cortex
ST1: fetal (13 - 26 postconception weeks), ST2: early infancy to late childhood (4 months to 11 years), and ST3: adolescence to adulthood (13 - 23 years)
The bar shown representes the lower 25% and upper 25% of the expression distribution.

No co-expressed genes in brain regions


Section III. Gene Ontology annotation

Molecular function 去的术语 Evidence Neuro keywords PubMed ID
GO:0005249 voltage-gated potassium channel activity IEA -
GO:0042802 identical protein binding IEA -
Biological process 去的术语 Evidence Neuro keywords PubMed ID
GO:0006260 DNA replication ISS 15726626
GO:0006813 potassium ion transport IEA -
Cellular component 去的术语 Evidence Neuro keywords PubMed ID
GO:0005634 nucleus IEA -
GO:0016020 membrane IEA -
GO:0008076 voltage-gated potassium channel complex IEA -

Section V. Pathway annotation

Pathway name Pathway size # SZGR 2.0 genes in pathway Info
GINESTIER BREAST CANCER ZNF217 AMPLIFIED DN 335 193 All SZGR 2.0 genes in this pathway
MULLIGHAN MLL SIGNATURE 1 UP 380 236 All SZGR 2.0 genes in this pathway
MULLIGHAN MLL SIGNATURE 2 UP 418 263 All SZGR 2.0 genes in this pathway
YOSHIMURA MAPK8 TARGETS UP 1305 895 All SZGR 2.0 genes in this pathway
JOHNSTONE PARVB TARGETS 2 UP 140 94 All SZGR 2.0 genes in this pathway
LEE BMP2 TARGETS DN 882 538 All SZGR 2.0 genes in this pathway
GOBERT OLIGODENDROCYTE DIFFERENTIATION DN 1080 713 All SZGR 2.0 genes in this pathway

Section VI. microRNA annotation

miRNA family Target position miRNA ID miRNA seq
UTR start UTR end Match method
miR-1/206 187 193 m8 hsa-miR-1 UGGAAUGUAAAGAAGUAUGUA
hsa-miR-206SZ UGGAAUGUAAGGAAGUGUGUGG
hsa-miR-613 AGGAAUGUUCCUUCUUUGCC