Gene Page:ZZZ3

Summary?
GeneID 26009
Symbol ZZZ3
Synonyms ATAC1
Description zinc finger ZZ-type containing 3
Reference HGNC:HGNC:24523|Ensembl:ENSG00000036549|HPRD:15907|Vega:OTTHUMG00000009652
Gene type protein-coding
Map location 1p31.1
Pascal p-value 0.045
Sherlock p-value 0.169

Gene in Data Sources
Gene set name Method of gene set Description Info
CV:PGCnp Genome-wide Association Study GWAS
GSMA_IIA Genome scan meta-analysis (All samples) Psr: 0.02692

Section I. Genetics and epigenetics annotation

@DNM table

Gene Chromosome Position Ref Alt Transcript AA change Mutation type Sift CG46 Trait Study
ZZZ3 chr1 78097966 T G NM_015534 . silent Schizophrenia DNM:Fromer_2014


Section II. Transcriptome annotation

General gene expression (GTEx)

Not available

Gene expression of temporal and spatial changes (BrainSpan)

Footnote:
SC: sub-cortical regions; SM: sensory-motor regions; FC: frontal cortex; and TP: temporal-parietal cortex
死神:胎儿(13 - 26 postconception weeks), ST2: early infancy to late childhood (4 months to 11 years), and ST3: adolescence to adulthood (13 - 23 years)
The bar shown representes the lower 25% and upper 25% of the expression distribution.

Top co-expressed genes in brain regions

Top 10 positively co-expressed genes
Gene Pearson's Correlation Spearman's Correlation
MST1 0.64 0.57
NEIL1 0.64 0.54
MYO15B 0.63 0.59
KIAA1683 0.63 0.49
KIAA1984 0.63 0.47
NBEAL2 0.63 0.52
PILRB 0.63 0.54
AC022382.1 0.63 0.48
PLA2G4B 0.62 0.53
DMPK 0.62 0.53
Top 10 negatively co-expressed genes
Gene Pearson's Correlation Spearman's Correlation
SNX3 -0.35 -0.36
PIGK -0.35 -0.37
C12orf5 -0.34 -0.37
DNAJB9 -0.34 -0.37
KBTBD3 -0.34 -0.40
GMFB -0.34 -0.36
PNPLA8 -0.34 -0.38
MTMR6 -0.34 -0.38
UBE2W -0.34 -0.36
ARPP19 -0.33 -0.33

Section III. Gene Ontology annotation

Molecular function 去的术语 Evidence Neuro keywords PubMed ID
GO:0003677 DNA binding IEA -
GO:0008270 zinc ion binding IEA -
GO:0046872 metal ion binding IEA -
Biological process 去的术语 Evidence Neuro keywords PubMed ID
GO:0006355 regulation of transcription, DNA-dependent IEA -
GO:0006350 transcription IEA -
Cellular component 去的术语 Evidence Neuro keywords PubMed ID
GO:0005634 nucleus IEA -

Section V. Pathway annotation

Pathway name Pathway size # SZGR 2.0 genes in pathway Info
KIM WT1 TARGETS DN 459 276 All SZGR 2.0 genes in this pathway
DODD NASOPHARYNGEAL CARCINOMA DN 1375 806 All SZGR 2.0 genes in this pathway
SCHLOSSER MYC TARGETS REPRESSED BY SERUM 159 93 All SZGR 2.0 genes in this pathway
DACOSTA UV RESPONSE VIA ERCC3 DN 855 609 All SZGR 2.0 genes in this pathway
DACOSTA UV RESPONSE VIA ERCC3 COMMON DN 483 336 All SZGR 2.0 genes in this pathway
PUJANA BRCA1 PCC NETWORK 1652 1023 All SZGR 2.0 genes in this pathway
PUJANA ATM PCC NETWORK 1442 892 All SZGR 2.0 genes in this pathway
JAIN NFKB SIGNALING 75 44 All SZGR 2.0 genes in this pathway
IVANOVA HEMATOPOIESIS EARLY PROGENITOR 532 309 All SZGR 2.0 genes in this pathway
DEBIASI APOPTOSIS BY REOVIRUS INFECTION UP 314 201 All SZGR 2.0 genes in this pathway
RAMALHO STEMNESS UP 206 118 All SZGR 2.0 genes in this pathway
DAZARD RESPONSE TO UV NHEK DN 318 220 All SZGR 2.0 genes in this pathway
DAZARD UV RESPONSE CLUSTER G6 153 112 All SZGR 2.0 genes in this pathway
CHEN HOXA5 TARGETS 9HR UP 223 132 All SZGR 2.0 genes in this pathway
COLINA TARGETS OF 4EBP1 AND 4EBP2 356 214 All SZGR 2.0 genes in this pathway
PILON KLF1 TARGETS DN 1972 1213 All SZGR 2.0 genes in this pathway

Section VI. microRNA annotation

miRNA family Target position miRNA ID miRNA seq
UTR start UTR end Match method
miR-128 1093 1099 1A hsa-miR-128a UCACAGUGAACCGGUCUCUUUU
hsa-miR-128b UCACAGUGAACCGGUCUCUUUC
miR-186 985 991 m8 hsa-miR-186 CAAAGAAUUCUCCUUUUGGGCUU
miR-27 1093 1099 m8 hsa-miR-27abrain UUCACAGUGGCUAAGUUCCGC
hsa-miR-27bbrain UUCACAGUGGCUAAGUUCUGC
miR-338 997 1003 1A hsa-miR-338brain UCCAGCAUCAGUGAUUUUGUUGA
miR-342 1095 1101 1A hsa-miR-342brain UCUCACACAGAAAUCGCACCCGUC
miR-34b 844 851 1A,m8 hsa-miR-34b UAGGCAGUGUCAUUAGCUGAUUG
miR-410 689 696 1A,m8 hsa-miR-410 AAUAUAACACAGAUGGCCUGU
miR-494 1034 1040 m8 hsa-miR-494brain UGAAACAUACACGGGAAACCUCUU