Gene Page:ARL5A

Summary?
GeneID 26225
Symbol ARL5A
Synonyms ARFLP5|ARL5
Description ADP ribosylation factor like GTPase 5A
Reference MIM:608960|HGNC:HGNC:696|HPRD:12343|
Gene type protein-coding
Map location 2q23.3
Pascal p-value 0.054
Sherlock p-value 0.706
Fetal beta 0.64
DMG 1 (# studies)
eGene Myers' cis & trans

Gene in Data Sources
Gene set name Method of gene set Description Info
CV:PGCnp Genome-wide Association Study GWAS
DMG:Jaffe_2016 Genome-wide DNA methylation analysis This dataset includes 2,104 probes/CpGs associated with SZ patients (n=108) compared to 136 controls at Bonferroni-adjusted P < 0.05. 1
GSMA_IIA Genome scan meta-analysis (All samples) Psr: 0.02395

Section I. Genetics and epigenetics annotation

@Differentially methylated gene

Probe Chromosome Position Nearest gene P (dis) Beta (dis) FDR (dis) Study
cg15228671 2 152685130 ARL5A 3.79E-8 -0.006 1.09E-5 DMG:Jaffe_2016

@eQTL annotation

SNP ID Chromosome Position eGene Gene Entrez ID pvalue qvalue TSS distance eQTL type
rs4491879 chr3 189373908 ARL5A 26225 0.08 trans
rs4505678 chr3 189374356 ARL5A 26225 0.16 trans
rs917836 chr18 20053367 ARL5A 26225 0.08 trans
rs12326929 chr18 70864592 ARL5A 26225 0.16 trans

Section II. Transcriptome annotation

General gene expression (GTEx)

Not available

Gene expression during devlopment (BrainCloud)

Footnote:
A total of 269 time points ploted, with n=38 fetal samples (x=1:38). Each triangle represents one time point.

Gene expression of temporal and spatial changes (BrainSpan)

Footnote:
SC: sub-cortical regions; SM: sensory-motor regions; FC: frontal cortex; and TP: temporal-parietal cortex
ST1: fetal (13 - 26 postconception weeks), ST2: early infancy to late childhood (4 months to 11 years), and ST3: adolescence to adulthood (13 - 23 years)
The bar shown representes the lower 25% and upper 25% of the expression distribution.

No co-expressed genes in brain regions


Section III. Gene Ontology annotation

Molecular function GO term Evidence Neuro keywords PubMed ID
GO:0000166 nucleotide binding IEA -
GO:0005525 GTP binding IEA -
Biological process GO term Evidence Neuro keywords PubMed ID
GO:0007264 small GTPase mediated signal transduction IEA -
Cellular component GO term Evidence Neuro keywords PubMed ID
GO:0005622 intracellular IEA -

Section V. Pathway annotation

Pathway name Pathway size # SZGR 2.0 genes in pathway Info
CHANDRAN METASTASIS TOP50 DN 45 26 All SZGR 2.0 genes in this pathway
DIAZ CHRONIC MEYLOGENOUS LEUKEMIA UP 1382 904 All SZGR 2.0 genes in this pathway
WANG LMO4 TARGETS UP 372 227 All SZGR 2.0 genes in this pathway
MARKEY RB1 CHRONIC LOF DN 118 78 All SZGR 2.0 genes in this pathway
SPIELMAN LYMPHOBLAST EUROPEAN VS ASIAN DN 584 395 All SZGR 2.0 genes in this pathway
BUYTAERT PHOTODYNAMIC THERAPY STRESS DN 637 377 All SZGR 2.0 genes in this pathway
WEI MYCN TARGETS WITH E BOX 795 478 All SZGR 2.0 genes in this pathway
MORI SMALL PRE BII LYMPHOCYTE UP 86 57 All SZGR 2.0 genes in this pathway
SANA TNF SIGNALING DN 90 57 All SZGR 2.0 genes in this pathway
特蕾西耐IFNA2 DN 32 23 All SZGR 2.0 genes in this pathway
BILD CTNNB1 ONCOGENIC SIGNATURE 82 52 All SZGR 2.0 genes in this pathway
KRIGE RESPONSE TO TOSEDOSTAT 6HR DN 911 527 All SZGR 2.0 genes in this pathway
KRIGE RESPONSE TO TOSEDOSTAT 24HR DN 1011 592 All SZGR 2.0 genes in this pathway
GAVIN FOXP3 TARGETS CLUSTER P3 160 103 All SZGR 2.0 genes in this pathway
MARTINEZ RB1 TARGETS UP 673 430 All SZGR 2.0 genes in this pathway
MARTINEZ TP53 TARGETS UP 602 364 All SZGR 2.0 genes in this pathway
MARTINEZ RB1 AND TP53 TARGETS UP 601 369 All SZGR 2.0 genes in this pathway
GOLDRATH ANTIGEN RESPONSE 346 192 All SZGR 2.0 genes in this pathway
YOSHIMURA MAPK8 TARGETS DN 366 257 All SZGR 2.0 genes in this pathway
LEE RECENT THYMIC EMIGRANT 227 128 All SZGR 2.0 genes in this pathway
MILI PSEUDOPODIA HAPTOTAXIS UP 518 299 All SZGR 2.0 genes in this pathway
CHANDRAN METASTASIS DN 306 191 All SZGR 2.0 genes in this pathway

Section VI. microRNA annotation

miRNA family Target position miRNA ID miRNA seq
UTR start UTR end Match method
let-7/98 473 479 1A hsa-let-7abrain UGAGGUAGUAGGUUGUAUAGUU
hsa-let-7bbrain UGAGGUAGUAGGUUGUGUGGUU
hsa-let-7cbrain UGAGGUAGUAGGUUGUAUGGUU
hsa-let-7dbrain AGAGGUAGUAGGUUGCAUAGU
hsa-let-7ebrain UGAGGUAGGAGGUUGUAUAGU
hsa-let-7fbrain UGAGGUAGUAGAUUGUAUAGUU
hsa-miR-98brain UGAGGUAGUAAGUUGUAUUGUU
hsa-let-7gSZ UGAGGUAGUAGUUUGUACAGU
hsa-let-7ibrain UGAGGUAGUAGUUUGUGCUGU
miR-129-5p 63 69 m8 hsa-miR-129brain CUUUUUGCGGUCUGGGCUUGC
hsa-miR-129-5p CUUUUUGCGGUCUGGGCUUGCU
miR-181 339 345 m8 hsa-miR-181abrain AACAUUCAACGCUGUCGGUGAGU
hsa-miR-181bSZ AACAUUCAUUGCUGUCGGUGGG
hsa-miR-181cbrain AACAUUCAACCUGUCGGUGAGU
hsa-miR-181dbrain AACAUUCAUUGUUGUCGGUGGGUU
miR-200bc/429 2256 2262 1A hsa-miR-200b UAAUACUGCCUGGUAAUGAUGAC
hsa-miR-200c UAAUACUGCCGGGUAAUGAUGG
hsa-miR-429 UAAUACUGUCUGGUAAAACCGU
miR-338 41 47 1A hsa-miR-338brain UCCAGCAUCAGUGAUUUUGUUGA
miR-450 63 69 1A hsa-miR-450 UUUUUGCGAUGUGUUCCUAAUA
miR-539 229 235 1A hsa-miR-539 GGAGAAAUUAUCCUUGGUGUGU
miR-543 340 347 1A,m8 hsa-miR-543 AAACAUUCGCGGUGCACUUCU