Gene Page:PTPN18
Summary?
GeneID | 26469 |
Symbol | PTPN18 |
Synonyms | BDP1|PTP-HSCF |
Description | protein tyrosine phosphatase, non-receptor type 18 |
Reference | MIM:606587|HGNC:HGNC:9649|Ensembl:ENSG00000072135|HPRD:05961|Vega:OTTHUMG00000131630 |
Gene type | protein-coding |
Map location | 2q21.1 |
Pascal p-value | 0.051 |
Fetal beta | -0.376 |
DMG | 1 (# studies) |
eGene | Caudate basal ganglia Cerebellum |
Gene in Data Sources
Gene set name | Method of gene set | Description | Info |
---|---|---|---|
CV:PGCnp | Genome-wide Association Study | GWAS | |
DMG:Wockner_2014 | Genome-wide DNA methylation analysis | This dataset includes 4641 differentially methylated probes corresponding to 2929 unique genes between schizophrenia patients (n=24) and controls (n=24). | 2 |
GSMA_I | Genome scan meta-analysis | Psr: 0.023 | |
GSMA_IIA | Genome scan meta-analysis (All samples) | Psr: 0.00755 |
Section I. Genetics and epigenetics annotation
Differentially methylated gene
Probe | Chromosome | Position | Nearest gene | P (dis) | Beta (dis) | FDR (dis) | Study |
---|---|---|---|---|---|---|---|
cg23979102 | 2 | 131116475 | PTPN18 | 1.713E-4 | -0.419 | 0.033 | DMG:Wockner_2014 |
cg05209645 | 2 | 131113386 | PTPN18 | 2.941E-4 | -0.263 | 0.039 | DMG:Wockner_2014 |
Section II. Transcriptome annotation
General gene expression (GTEx)
![Not available](http://www.tjghsg.com/bioinfo/SZGR/GeneImg/PTPN18_DE_GTEx.png)
Gene expression during devlopment (BrainCloud)
Footnote:
A total of 269 time points ploted, with n=38 fetal samples (x=1:38). Each triangle represents one time point.
Gene expression of temporal and spatial changes (BrainSpan)
Footnote:
SC: sub-cortical regions; SM: sensory-motor regions; FC: frontal cortex; and TP: temporal-parietal cortex
死神:胎儿(13 - 26 postconceptionweeks), ST2: early infancy to late childhood (4 months to 11 years), and ST3: adolescence to adulthood (13 - 23 years)
The bar shown representes the lower 25% and upper 25% of the expression distribution.
No co-expressed genes in brain regions
Section III. Gene Ontology annotation
Molecular function | 去的术语 | Evidence | Neuro keywords | PubMed ID |
---|---|---|---|---|
GO:0005515 | protein binding | IEA | - | |
GO:0004726 | non-membrane spanning protein tyrosine phosphatase activity | IEA | - | |
GO:0004726 | non-membrane spanning protein tyrosine phosphatase activity | TAS | 8950995 | |
GO:0016787 | hydrolase activity | IEA | - | |
GO:0016791 | phosphatase activity | IEA | - | |
Biological process | 去的术语 | Evidence | Neuro keywords | PubMed ID |
GO:0006470 | protein amino acid dephosphorylation | IEA | - | |
GO:0006470 | protein amino acid dephosphorylation | TAS | 8950995 | |
Cellular component | 去的术语 | Evidence | Neuro keywords | PubMed ID |
GO:0005634 | nucleus | IEA | - | |
GO:0005737 | cytoplasm | IEA | - |
Section V. Pathway annotation
Pathway name | Pathway size | # SZGR 2.0 genes in pathway | Info |
---|---|---|---|
PARENT MTOR SIGNALING UP | 567 | 375 | All SZGR 2.0 genes in this pathway |
HUTTMANN B CLL POOR SURVIVAL UP | 276 | 187 | All SZGR 2.0 genes in this pathway |
PUJANA ATM PCC NETWORK | 1442 | 892 | All SZGR 2.0 genes in this pathway |
NUYTTEN EZH2 TARGETS DN | 1024 | 594 | All SZGR 2.0 genes in this pathway |
BUYTAERT PHOTODYNAMIC THERAPY STRESS DN | 637 | 377 | All SZGR 2.0 genes in this pathway |
IIZUKA LIVER CANCER PROGRESSION L0 L1 UP | 17 | 12 | All SZGR 2.0 genes in this pathway |
PENG RAPAMYCIN RESPONSE UP | 203 | 130 | All SZGR 2.0 genes in this pathway |
NADLER HYPERGLYCEMIA AT OBESITY | 58 | 35 | All SZGR 2.0 genes in this pathway |
BASSO CD40 SIGNALING DN | 68 | 44 | All SZGR 2.0 genes in this pathway |
CHIARETTI ACUTE LYMPHOBLASTIC LEUKEMIA ZAP70 | 67 | 33 | All SZGR 2.0 genes in this pathway |
KYNG DNA DAMAGE BY UV | 62 | 43 | All SZGR 2.0 genes in this pathway |
KYNG DNA DAMAGE DN | 195 | 135 | All SZGR 2.0 genes in this pathway |
QI PLASMACYTOMA UP | 259 | 185 | All SZGR 2.0 genes in this pathway |
CHEN METABOLIC SYNDROM NETWORK | 1210 | 725 | All SZGR 2.0 genes in this pathway |
MEISSNER BRAIN HCP WITH H3K4ME3 AND H3K27ME3 | 1069 | 729 | All SZGR 2.0 genes in this pathway |
HOSHIDA LIVER CANCER SURVIVAL DN | 113 | 76 | All SZGR 2.0 genes in this pathway |
PILON KLF1 TARGETS DN | 1972 | 1213 | All SZGR 2.0 genes in this pathway |
TORCHIA TARGETS OF EWSR1 FLI1 FUSION DN | 321 | 200 | All SZGR 2.0 genes in this pathway |
PLASARI TGFB1 SIGNALING VIA NFIC 10HR DN | 30 | 25 | All SZGR 2.0 genes in this pathway |
Section VI. microRNA annotation
miRNA family | Target position | miRNA ID | miRNA seq | ||
---|---|---|---|---|---|
UTR start | UTR end | Match method | |||
miR-125/351 | 116 | 122 | m8 | hsa-miR-125bbrain | UCCCUGAGACCCUAACUUGUGA |
hsa-miR-125abrain | UCCCUGAGACCCUUUAACCUGUG | ||||
miR-539 | 113 | 119 | 1A | hsa-miR-539 | GGAGAAAUUAUCCUUGGUGUGU |
- SZ: miRNAs which differentially expressed in brain cortex of schizophrenia patients comparing with control samples using microarray. Clickhereto see the list of SZ related miRNAs.
- Brain: miRNAs which are expressed in brain based on miRNA microarray expression studies. Clickhereto see the list of brain related miRNAs.