Gene Page:PTPN18

Summary?
GeneID 26469
Symbol PTPN18
Synonyms BDP1|PTP-HSCF
Description protein tyrosine phosphatase, non-receptor type 18
Reference MIM:606587|HGNC:HGNC:9649|Ensembl:ENSG00000072135|HPRD:05961|Vega:OTTHUMG00000131630
Gene type protein-coding
Map location 2q21.1
Pascal p-value 0.051
Fetal beta -0.376
DMG 1 (# studies)
eGene Caudate basal ganglia
Cerebellum

Gene in Data Sources
Gene set name Method of gene set Description Info
CV:PGCnp Genome-wide Association Study GWAS
DMG:Wockner_2014 Genome-wide DNA methylation analysis This dataset includes 4641 differentially methylated probes corresponding to 2929 unique genes between schizophrenia patients (n=24) and controls (n=24). 2
GSMA_I Genome scan meta-analysis Psr: 0.023
GSMA_IIA Genome scan meta-analysis (All samples) Psr: 0.00755

Section I. Genetics and epigenetics annotation

@Differentially methylated gene

Probe Chromosome Position Nearest gene P (dis) Beta (dis) FDR (dis) Study
cg23979102 2 131116475 PTPN18 1.713E-4 -0.419 0.033 DMG:Wockner_2014
cg05209645 2 131113386 PTPN18 2.941E-4 -0.263 0.039 DMG:Wockner_2014


Section II. Transcriptome annotation

General gene expression (GTEx)

Not available

Gene expression during devlopment (BrainCloud)

Footnote:
A total of 269 time points ploted, with n=38 fetal samples (x=1:38). Each triangle represents one time point.

Gene expression of temporal and spatial changes (BrainSpan)

Footnote:
SC: sub-cortical regions; SM: sensory-motor regions; FC: frontal cortex; and TP: temporal-parietal cortex
死神:胎儿(13 - 26 postconceptionweeks), ST2: early infancy to late childhood (4 months to 11 years), and ST3: adolescence to adulthood (13 - 23 years)
The bar shown representes the lower 25% and upper 25% of the expression distribution.

No co-expressed genes in brain regions


Section III. Gene Ontology annotation

Molecular function 去的术语 Evidence Neuro keywords PubMed ID
GO:0005515 protein binding IEA -
GO:0004726 non-membrane spanning protein tyrosine phosphatase activity IEA -
GO:0004726 non-membrane spanning protein tyrosine phosphatase activity TAS 8950995
GO:0016787 hydrolase activity IEA -
GO:0016791 phosphatase activity IEA -
Biological process 去的术语 Evidence Neuro keywords PubMed ID
GO:0006470 protein amino acid dephosphorylation IEA -
GO:0006470 protein amino acid dephosphorylation TAS 8950995
Cellular component 去的术语 Evidence Neuro keywords PubMed ID
GO:0005634 nucleus IEA -
GO:0005737 cytoplasm IEA -

Section V. Pathway annotation

Pathway name Pathway size # SZGR 2.0 genes in pathway Info
PARENT MTOR SIGNALING UP 567 375 All SZGR 2.0 genes in this pathway
HUTTMANN B CLL POOR SURVIVAL UP 276 187 All SZGR 2.0 genes in this pathway
PUJANA ATM PCC NETWORK 1442 892 All SZGR 2.0 genes in this pathway
NUYTTEN EZH2 TARGETS DN 1024 594 All SZGR 2.0 genes in this pathway
BUYTAERT PHOTODYNAMIC THERAPY STRESS DN 637 377 All SZGR 2.0 genes in this pathway
IIZUKA LIVER CANCER PROGRESSION L0 L1 UP 17 12 All SZGR 2.0 genes in this pathway
PENG RAPAMYCIN RESPONSE UP 203 130 All SZGR 2.0 genes in this pathway
NADLER HYPERGLYCEMIA AT OBESITY 58 35 All SZGR 2.0 genes in this pathway
BASSO CD40 SIGNALING DN 68 44 All SZGR 2.0 genes in this pathway
CHIARETTI ACUTE LYMPHOBLASTIC LEUKEMIA ZAP70 67 33 All SZGR 2.0 genes in this pathway
KYNG DNA DAMAGE BY UV 62 43 All SZGR 2.0 genes in this pathway
KYNG DNA DAMAGE DN 195 135 All SZGR 2.0 genes in this pathway
QI PLASMACYTOMA UP 259 185 All SZGR 2.0 genes in this pathway
CHEN METABOLIC SYNDROM NETWORK 1210 725 All SZGR 2.0 genes in this pathway
MEISSNER BRAIN HCP WITH H3K4ME3 AND H3K27ME3 1069 729 All SZGR 2.0 genes in this pathway
HOSHIDA LIVER CANCER SURVIVAL DN 113 76 All SZGR 2.0 genes in this pathway
PILON KLF1 TARGETS DN 1972 1213 All SZGR 2.0 genes in this pathway
TORCHIA TARGETS OF EWSR1 FLI1 FUSION DN 321 200 All SZGR 2.0 genes in this pathway
PLASARI TGFB1 SIGNALING VIA NFIC 10HR DN 30 25 All SZGR 2.0 genes in this pathway

Section VI. microRNA annotation

miRNA family Target position miRNA ID miRNA seq
UTR start UTR end Match method
miR-125/351 116 122 m8 hsa-miR-125bbrain UCCCUGAGACCCUAACUUGUGA
hsa-miR-125abrain UCCCUGAGACCCUUUAACCUGUG
miR-539 113 119 1A hsa-miR-539 GGAGAAAUUAUCCUUGGUGUGU