Gene Page:GCNT2
Summary?
GeneID | 2651 |
Symbol | GCNT2 |
Synonyms | CCAT|CTRCT13|GCNT2C|GCNT5|IGNT|II|NACGT1|NAGCT1|ULG3|bA360O19.2|bA421M1.1 |
Description | glucosaminyl (N-acetyl) transferase 2, I-branching enzyme (I blood group) |
Reference | MIM:600429|HGNC:HGNC:4204|Ensembl:ENSG00000111846|HPRD:02695|Vega:OTTHUMG00000014244 |
Gene type | protein-coding |
Map location | 6p24.2 |
Pascal p-value | 0.382 |
Fetal beta | -0.539 |
Gene in Data Sources
Gene set name | Method of gene set | Description | Info |
---|---|---|---|
CV:PGCnp | Genome-wide Association Study | GWAS | |
PMID:cooccur | High-throughput literature-search | 系统搜索PubMed co-o基因ccurring with SCZ keywords. A total of 3027 genes were included. | |
GSMA_I | Genome scan meta-analysis | Psr: 0.0159 | |
Literature | High-throughput literature-search | Co-occurance with Schizophrenia keywords: schizophrenia,schizophrenias | Click to show details |
Section I. Genetics and epigenetics annotation
DNM table
Gene | Chromosome | Position | Ref | Alt | Transcript | AA change | Mutation type | Sift | CG46 | Trait | Study |
---|---|---|---|---|---|---|---|---|---|---|---|
GCNT2 | chr6 | 10586366 | C | G | NM_001491 NM_145649 NM_145655 |
. . . |
intronic intronic silent |
Schizophrenia | DNM:Gulsuner_2013 |
Section II. Transcriptome annotation
General gene expression (GTEx)
![Not available](http://www.tjghsg.com/bioinfo/SZGR/GeneImg/GCNT2_DE_GTEx.png)
Gene expression during devlopment (BrainCloud)
Footnote:
A total of 269 time points ploted, with n=38 fetal samples (x=1:38). Each triangle represents one time point.
Gene expression of temporal and spatial changes (BrainSpan)
Footnote:
SC: sub-cortical regions; SM: sensory-motor regions; FC: frontal cortex; and TP: temporal-parietal cortex
ST1: fetal (13 - 26 postconception weeks), ST2: early infancy to late childhood (4 months to 11 years), and ST3: adolescence to adulthood (13 - 23 years)
The bar shown representes the lower 25% and upper 25% of the expression distribution.
No co-expressed genes in brain regions
Section III. Gene Ontology annotation
Molecular function | 去的术语 | Evidence | Neuro keywords | PubMed ID |
---|---|---|---|---|
GO:0008375 | acetylglucosaminyltransferase activity | IEA | - | |
GO:0016757 | transferase activity, transferring glycosyl groups | IEA | - | |
GO:0016740 | transferase activity | IEA | - | |
GO:0008109 | N-acetyllactosaminide beta-1,6-N-acetylglucosaminyltransferase activity | TAS | 8449405 | |
Biological process | 去的术语 | Evidence | Neuro keywords | PubMed ID |
GO:0006024 | glycosaminoglycan biosynthetic process | TAS | 8449405 | |
GO:0007275 | multicellular organismal development | TAS | 9134435 | |
Cellular component | 去的术语 | Evidence | Neuro keywords | PubMed ID |
GO:0000139 | Golgi membrane | IEA | - | |
GO:0005794 | Golgi apparatus | IEA | - | |
GO:0005624 | membrane fraction | TAS | 8449405 | |
GO:0016020 | membrane | IEA | - | |
GO:0016021 | integral to membrane | IEA | - |
Section V. Pathway annotation
Pathway name | Pathway size | # SZGR 2.0 genes in pathway | Info |
---|---|---|---|
KEGG GLYCOSPHINGOLIPID BIOSYNTHESIS LACTO AND NEOLACTO SERIES | 26 | 19 | All SZGR 2.0 genes in this pathway |
HORIUCHI WTAP TARGETS UP | 306 | 188 | All SZGR 2.0 genes in this pathway |
VECCHI GASTRIC CANCER EARLY DN | 367 | 220 | All SZGR 2.0 genes in this pathway |
SENESE HDAC3 TARGETS DN | 536 | 332 | All SZGR 2.0 genes in this pathway |
SABATES COLORECTAL ADENOMA DN | 291 | 176 | All SZGR 2.0 genes in this pathway |
COLDREN GEFITINIB RESISTANCE DN | 230 | 115 | All SZGR 2.0 genes in this pathway |
MARKEY RB1 ACUTE LOF UP | 215 | 137 | All SZGR 2.0 genes in this pathway |
GRAESSMANN APOPTOSIS BY SERUM DEPRIVATION DN | 234 | 147 | All SZGR 2.0 genes in this pathway |
GRAESSMANN RESPONSE TO MC AND SERUM DEPRIVATION DN | 84 | 54 | All SZGR 2.0 genes in this pathway |
GRAESSMANN APOPTOSIS BY DOXORUBICIN UP | 1142 | 669 | All SZGR 2.0 genes in this pathway |
PEREZ TP53 TARGETS | 1174 | 695 | All SZGR 2.0 genes in this pathway |
NUYTTEN EZH2 TARGETS UP | 1037 | 673 | All SZGR 2.0 genes in this pathway |
RICKMAN TUMOR DIFFERENTIATED WELL VS POORLY UP | 236 | 139 | All SZGR 2.0 genes in this pathway |
POMEROY MEDULLOBLASTOMA DESMOPLASIC VS CLASSIC DN | 59 | 35 | All SZGR 2.0 genes in this pathway |
HESS TARGETS OF HOXA9 AND MEIS1 DN | 77 | 48 | All SZGR 2.0 genes in this pathway |
HOEGERKORP CD44 TARGETS DIRECT UP | 27 | 21 | All SZGR 2.0 genes in this pathway |
KAYO AGING MUSCLE UP | 244 | 165 | All SZGR 2.0 genes in this pathway |
KAAB HEART ATRIUM VS VENTRICLE DN | 261 | 183 | All SZGR 2.0 genes in this pathway |
MONNIER POSTRADIATION TUMOR ESCAPE DN | 373 | 196 | All SZGR 2.0 genes in this pathway |
FOSTER TOLERANT MACROPHAGE DN | 409 | 268 | All SZGR 2.0 genes in this pathway |
COULOUARN TEMPORAL TGFB1 SIGNATURE DN | 138 | 99 | All SZGR 2.0 genes in this pathway |
YAO TEMPORAL RESPONSE TO PROGESTERONE CLUSTER 2 | 86 | 50 | All SZGR 2.0 genes in this pathway |
LI INDUCED T TO NATURAL KILLER UP | 307 | 182 | All SZGR 2.0 genes in this pathway |
JOHNSTONE PARVB TARGETS 2 DN | 336 | 211 | All SZGR 2.0 genes in this pathway |
TORCHIA TARGETS OF EWSR1 FLI1 FUSION DN | 321 | 200 | All SZGR 2.0 genes in this pathway |
HUANG GATA2 TARGETS UP | 149 | 96 | All SZGR 2.0 genes in this pathway |
PLASARI TGFB1 TARGETS 10HR UP | 199 | 143 | All SZGR 2.0 genes in this pathway |
RAO BOUND BY SALL4 | 227 | 149 | All SZGR 2.0 genes in this pathway |
ROESSLER LIVER CANCER METASTASIS UP | 107 | 72 | All SZGR 2.0 genes in this pathway |
Section VI. microRNA annotation
miRNA family | Target position | miRNA ID | miRNA seq | ||
---|---|---|---|---|---|
UTR start | UTR end | Match method | |||
miR-144 | 354 | 360 | m8 | hsa-miR-144 | UACAGUAUAGAUGAUGUACUAG |
miR-199 | 2527 | 2534 | 1A,m8 | hsa-miR-199a | CCCAGUGUUCAGACUACCUGUUC |
hsa-miR-199b | CCCAGUGUUUAGACUAUCUGUUC | ||||
miR-30-5p | 2573 | 2580 | 1A,m8 | hsa-miR-30a-5p | UGUAAACAUCCUCGACUGGAAG |
hsa-miR-30cbrain | UGUAAACAUCCUACACUCUCAGC | ||||
hsa-miR-30dSZ | UGUAAACAUCCCCGACUGGAAG | ||||
hsa-miR-30bSZ | UGUAAACAUCCUACACUCAGCU | ||||
hsa-miR-30e-5p | UGUAAACAUCCUUGACUGGA | ||||
miR-326 | 1542 | 1548 | 1A | hsa-miR-326 | CCUCUGGGCCCUUCCUCCAG |
- SZ: miRNAs which differentially expressed in brain cortex of schizophrenia patients comparing with control samples using microarray. Clickhereto see the list of SZ related miRNAs.
- Brain: miRNAs which are expressed in brain based on miRNA microarray expression studies. Clickhereto see the list of brain related miRNAs.