Gene Page:MDGA1

概括?
基因 266727
Symbol MDGA1
Synonyms GPIM|MAMDC3
Description MAM domain containing glycosylphosphatidylinositol anchor 1
Reference MIM:609626|HGNC:HGNC:19267|Ensembl:ENSG00000112139|HPRD:14374|Vega:OTTHUMG00000014626
Gene type protein-coding
Map location 6p21
Pascal p-value 0.031
Sherlock p-value 0.865
Fetal beta 0.207
DMG 1 (# studies)
eGene Cerebellar Hemisphere
Cerebellum
Myers' cis & trans

Gene in Data Sources
Gene set name Method of gene set Description Info
CV:PGCnp Genome-wide Association Study GWAS
DMG:Jaffe_2016 Genome-wide DNA methylation analysis This dataset includes 2,104 probes/CpGs associated with SZ patients (n=108) compared to 136 controls at Bonferroni-adjusted P < 0.05. 2
PMID:cooccur High-throughput literature-search 系统搜索PubMed genes co-occurring with SCZ keywords. A total of 3027 genes were included.
GSMA_I Genome scan meta-analysis Psr: 0.033
GSMA_IIE Genome scan meta-analysis (European-ancestry samples) Psr: 0.04433
Literature High-throughput literature-search Co-occurance with Schizophrenia keywords: schizophrenia,schizophrenias Click to show details
GO_Annotation Mapping neuro-related keywords to Gene Ontology annotations Hits with neuro-related keywords: 4

Section I. Genetics and epigenetics annotation

@Differentially methylated gene

Probe Chromosome Position Nearest gene P (dis) Beta (dis) FDR (dis) Study
cg21041911 6 37673439 MDGA1 9.83E-11 -0.012 4.49E-7 DMG:Jaffe_2016
cg03356760 6 37665051 MDGA1 5.42E-9 -0.016 3E-6 DMG:Jaffe_2016

@eQTL annotation

SNP ID Chromosome Position eGene Gene Entrez ID pvalue qvalue TSS distance eQTL type
rs16890367 chr6 38078448 MDGA1 266727 0.04 cis
rs17392743 chr1 54764240 MDGA1 266727 0.11 trans
rs6687849 chr1 175904808 MDGA1 266727 0.01 trans
rs2481653 chr1 176044120 MDGA1 266727 0.05 trans
rs2502827 chr1 176044216 MDGA1 266727 1.037E-4 trans
rs12405921 chr1 206695730 MDGA1 266727 0.01 trans
rs17572651 chr1 218943612 MDGA1 266727 0 trans
rs16829545 chr2 151977407 MDGA1 266727 9.864E-12 trans
rs3845734 chr2 171125572 MDGA1 266727 1.266E-5 trans
rs7584986 chr2 184111432 MDGA1 266727 2.161E-11 trans
rs6807632 chr3 111395567 MDGA1 266727 0.05 trans
rs17762315 chr5 76807576 MDGA1 266727 5.228E-4 trans
rs7729096 chr5 76835927 MDGA1 266727 0.03 trans
RS1368303 chr5 147672388 MDGA1 266727 3.868E-4 trans
rs17079498 chr8 3018343 MDGA1 266727 0.13 trans
rs11139334 chr9 84209393 MDGA1 266727 0.07 trans
rs2766987 chr9 113667956 MDGA1 266727 0.11 trans
rs2393316 chr10 59333070 MDGA1 266727 0.17 trans
rs7996604 chr13 42224412 MDGA1 266727 0.14 trans
rs1629937 chr14 77059671 MDGA1 266727 0.12 trans
rs17104720 chr14 77127308 MDGA1 266727 0 trans
RS6574467 chr14 79179744 MDGA1 266727 0.1 trans
rs10146003 chr14 79191170 MDGA1 266727 0.1 trans
rs16955618 chr15 29937543 MDGA1 266727 2.589E-29 trans
snp_a-1830894 0 MDGA1 266727 0.11 trans
rs1041786 chr21 22617710 MDGA1 266727 0 trans

Section II. Transcriptome annotation

General gene expression (GTEx)

Not available

Gene expression during devlopment (BrainCloud)

Footnote:
A total of 269 time points ploted, with n=38 fetal samples (x=1:38). Each triangle represents one time point.

Gene expression of temporal and spatial changes (BrainSpan)

Footnote:
SC: sub-cortical regions; SM: sensory-motor regions; FC: frontal cortex; and TP: temporal-parietal cortex
ST1: fetal (13 - 26 postconception weeks), ST2: early infancy to late childhood (4 months to 11 years), and ST3: adolescence to adulthood (13 - 23 years)
The bar shown representes the lower 25% and upper 25% of the expression distribution.

No co-expressed genes in brain regions


Section III. Gene Ontology annotation

Molecular function 去的术语 Evidence Neuro keywords PubMed ID
GO:0003674 molecular_function ND -
Biological process 去的术语 Evidence Neuro keywords PubMed ID
GO:0007420 brain development ISS Brain (GO term level: 7) 15019943
GO:0001764 neuron migration ISS neuron (GO term level: 8) -
GO:0021527 spinal cord association neuron differentiation ISS neuron (GO term level: 9) 15019943
GO:0007399 nervous system development IEA neurite (GO term level: 5) -
GO:0007275 multicellular organismal development IEA -
GO:0030154 cell differentiation IEA -
Cellular component 去的术语 Evidence Neuro keywords PubMed ID
去：0016020 membrane IEA -
GO:0005886 plasma membrane IEA -
GO:0046658 anchored to plasma membrane IDA 15922729

Section V. Pathway annotation

Pathway name Pathway size # SZGR 2.0 genes in pathway Info
BENPORATH EED TARGETS 1062 725 All SZGR 2.0 genes in this pathway
IVANOVA HEMATOPOIESIS STEM CELL AND PROGENITOR 681 420 All SZGR 2.0 genes in this pathway
MARIADASON RESPONSE TO BUTYRATE SULINDAC 6 52 32 All SZGR 2.0 genes in this pathway
MEISSNER BRAIN HCP WITH H3K4ME3 AND H3K27ME3 1069 729 All SZGR 2.0 genes in this pathway
CHYLA CBFA2T3 TARGETS UP 387 225 All SZGR 2.0 genes in this pathway
KASLER HDAC7 TARGETS 2 DN 32 23 All SZGR 2.0 genes in this pathway

Section VI. microRNA annotation

miRNA family Target position miRNA ID miRNA seq
UTR start UTR end Match method
miR-103/107 590 596 1A hsa-miR-103brain AGCAGCAUUGUACAGGGCUAUGA
HSA-MIR-107brain AGCAGCAUUGUACAGGGCUAUCA
miR-124.1 3099 3105 1A hsa-miR-124a UUAAGGCACGCGGUGAAUGCCA
miR-141/200a 4840 4846 m8 hsa-miR-141 uaacacugucugugugugugaugg
hsa-miR-200a UAACACUGUCUGGUAACGAUGU
miR-18 273 279 m8 hsa-miR-18a UAAGGUGCAUCUAGUGCAGAUA
hsa-miR-18b UAAGGUGCAUCUAGUGCAGUUA
miR-218 246 253 1A,m8 hsa-miR-218brain UUGUGCUUGAUCUAACCAUGU
hsa-miR-218brain UUGUGCUUGAUCUAACCAUGU
miR-485-5p 4749 4755 m8 hsa-miR-485-5p AGAGGCUGGCCGUGAUGAAUUC
miR-9 42 48 m8 hsa-miR-9SZ UCUUUGGUUAUCUAGCUGUAUGA
hsa-miR-9SZ UCUUUGGUUAUCUAGCUGUAUGA