Gene Page:CYFIP2

Summary?
GeneID 26999
Symbol CYFIP2
Synonyms PIR121
Description cytoplasmic FMR1 interacting protein 2
Reference MIM:606323|HGNC:HGNC:13760|Ensembl:ENSG00000055163|HPRD:07556|Vega:OTTHUMG00000163484
Gene type protein-coding
地图的地区n 5q33.3
Pascal p-value 0.544
Sherlock p-value 0.33
Fetal beta -1.081
DMG 1 (# studies)
eGene Myers' cis & trans
支持 G2Cdb.human_BAYES-COLLINS-HUMAN-PSD-CONSENSUS
G2Cdb.human_BAYES-COLLINS-HUMAN-PSD-FULL
G2Cdb.human_BAYES-COLLINS-MOUSE-PSD-CONSENSUS
G2Cdb.humanPSD
G2Cdb.humanPSP
CompositeSet
Darnell FMRP targets
Ascano FMRP targets

Gene in Data Sources
Gene set name Method of gene set Description Info
CV:GWASdb Genome-wide Association Studies GWASdb records for schizophrenia
CV:PGCnp Genome-wide Association Study GWAS
DMG:Wockner_2014 Genome-wide DNA methylation analysis This dataset includes 4641 differentially methylated probes corresponding to 2929 unique genes between schizophrenia patients (n=24) and controls (n=24). 2
PMID:cooccur High-throughput literature-search Systematic search in PubMed for genes co-occurring with SCZ keywords. A total of 3027 genes were included.
GSMA_I Genome scan meta-analysis Psr: 0.0032
GSMA_IIE Genome scan meta-analysis (European-ancestry samples) Psr: 0.01718
GSMA_IIA Genome scan meta-analysis (All samples) Psr: 0.00459
Literature High-throughput literature-search Co-occurance with Schizophrenia keywords: schizophrenia,schizophrenias Click to show details
GO_Annotation Mapping neuro-related keywords to Gene Ontology annotations Hits with neuro-related keywords: 1

Section I. Genetics and epigenetics annotation

@Differentially methylated gene

探针 Chromosome Position Nearest gene P (dis) Beta (dis) FDR (dis) Study
cg26790059 5 156772562 CYFIP2;C5orf40 1.965E-4 0.549 0.035 DMG:Wockner_2014
cg20938157 5 156693294 CYFIP2 2.57E-4 -0.37 0.038 DMG:Wockner_2014

@eQTL annotation

SNP ID Chromosome Position eGene Gene Entrez ID pvalue qvalue TSS distance eQTL type
rs1327280 chr6 51252704 CYFIP2 26999 0.16 trans

Section II. Transcriptome annotation

General gene expression (GTEx)

Not available

Gene expression during devlopment (BrainCloud)

Footnote:
A total of 269 time points ploted, with n=38 fetal samples (x=1:38). Each triangle represents one time point.

Gene expression of temporal and spatial changes (BrainSpan)

Footnote:
SC: sub-cortical regions; SM: sensory-motor regions; FC: frontal cortex; and TP: temporal-parietal cortex
ST1: fetal (13 - 26 postconception weeks), ST2: early infancy to late childhood (4 months to 11 years), and ST3: adolescence to adulthood (13 - 23 years)
The bar shown representes the lower 25% and upper 25% of the expression distribution.

Top co-expressed genes in brain regions

Top 10 positively co-expressed genes
Gene Pearson's Correlation Spearman's Correlation
ANKRD13D 0.88 0.88
ACOT7 0.84 0.82
PPP2R5B 0.83 0.81
SYT3 0.83 0.81
REEP2 0.83 0.83
RTN2 0.83 0.83
FSD1 0.83 0.84
MGAT4B 0.83 0.81
PRAF2 0.83 0.81
PCTK1 0.82 0.82
Top 10 negatively co-expressed genes
Gene Pearson's Correlation Spearman's Correlation
AF347015.2 -0.61 -0.55
AF347015.8 -0.59 -0.52
AF347015.33 -0.58 -0.52
AF347015.27 -0.58 -0.53
MT-CO2 -0.58 -0.50
AF347015.31 -0.57 -0.50
MT-CYB -0.57 -0.51
AF347015.21 -0.57 -0.51
MT-ATP8 -0.56 -0.55
AF347015.15 -0.55 -0.49

Section III. Gene Ontology annotation

Molecular function 去的术语 Evidence Neuro keywords PubMed ID
GO:0005515 protein binding 新闻学会 15048733
Biological process 去的术语 Evidence Neuro keywords PubMed ID
GO:0006915 apoptosis IDA 10449408
GO:0016337 cell-cell adhesion IDA 15048733
Cellular component 去的术语 Evidence Neuro keywords PubMed ID
GO:0019717 synaptosome IDA Synap, Brain (GO term level: 7) 11438699
GO:0045202 synapse IEA neuron, Synap, Neurotransmitter, Glial (GO term level: 2) -
GO:0005737 cytoplasm IDA 11438699
GO:0048471 perinuclear region of cytoplasm IDA 10449408
GO:0030054 cell junction IEA -

Section V. Pathway annotation

Pathway name Pathway size # SZGR 2.0 genes in pathway Info
KEGG REGULATION OF ACTIN CYTOSKELETON 216 144 All SZGR 2.0 genes in this pathway
PID ECADHERIN NASCENT AJ PATHWAY 39 33 All SZGR 2.0 genes in this pathway
PID ERBB1 DOWNSTREAM PATHWAY 105 78 All SZGR 2.0 genes in this pathway
PID PDGFRB PATHWAY 129 103 All SZGR 2.0 genes in this pathway
PID ECADHERIN STABILIZATION PATHWAY 42 34 All SZGR 2.0 genes in this pathway
PID RAC1 PATHWAY 54 37 All SZGR 2.0 genes in this pathway
GAZDA DIAMOND BLACKFAN ANEMIA ERYTHROID DN 493 298 All SZGR 2.0 genes in this pathway
DOANE RESPONSE TO ANDROGEN DN 241 146 All SZGR 2.0 genes in this pathway
ROY WOUND BLOOD VESSEL UP 50 30 All SZGR 2.0 genes in this pathway
RODRIGUES THYROID CARCINOMA ANAPLASTIC DN 537 339 All SZGR 2.0 genes in this pathway
DELYS THYROID CANCER UP 443 294 All SZGR 2.0 genes in this pathway
PEREZ TP53 TARGETS 1174 695 All SZGR 2.0 genes in this pathway
CEBALLOS TARGETS OF TP53 AND MYC DN 38 31 All SZGR 2.0 genes in this pathway
ALCALA APOPTOSIS 88 60 All SZGR 2.0 genes in this pathway
LOPEZ MBD TARGETS 957 597 All SZGR 2.0 genes in this pathway
KOYAMA SEMA3B TARGETS UP 292 168 All SZGR 2.0 genes in this pathway
PASQUALUCCI LYMPHOMA BY GC STAGE DN 165 104 All SZGR 2.0 genes in this pathway
STARK PREFRONTAL CORTEX 22Q11 DELETION UP 195 138 All SZGR 2.0 genes in this pathway
MORI EMU MYC LYMPHOMA BY ONSET TIME UP 110 69 All SZGR 2.0 genes in this pathway
ONDER CDH1 TARGETS 2 UP 256 159 All SZGR 2.0 genes in this pathway
GOLUB ALL VS AML UP 24 20 All SZGR 2.0 genes in this pathway
SANSOM APC TARGETS DN 366 238 All SZGR 2.0 genes in this pathway
HADDAD B LYMPHOCYTE PROGENITOR 293 193 All SZGR 2.0 genes in this pathway
GREENBAUM E2A TARGETS DN 21 11 All SZGR 2.0 genes in this pathway
PETROVA ENDOTHELIUM LYMPHATIC VS BLOOD DN 162 102 All SZGR 2.0 genes in this pathway
ALCALAY AML BY NPM1 LOCALIZATION DN 184 132 All SZGR 2.0 genes in this pathway
REN ALVEOLAR RHABDOMYOSARCOMA UP 98 64 All SZGR 2.0 genes in this pathway
RAMALHO STEMNESS DN 74 55 All SZGR 2.0 genes in this pathway
NIELSEN LIPOSARCOMA DN 19 8 All SZGR 2.0 genes in this pathway
MCLACHLAN DENTAL CARIES DN 245 144 All SZGR 2.0 genes in this pathway
LEIN NEURON MARKERS 69 45 All SZGR 2.0 genes in this pathway
ACEVEDO LIVER TUMOR VS NORMAL ADJACENT TISSUE DN 274 165 All SZGR 2.0 genes in this pathway
KUMAMOTO RESPONSE TO NUTLIN 3A UP 9 5 All SZGR 2.0 genes in this pathway
CHAUHAN RESPONSE TO METHOXYESTRADIOL DN 102 65 All SZGR 2.0 genes in this pathway
LEE DIFFERENTIATING T LYMPHOCYTE 200 115 All SZGR 2.0 genes in this pathway
HAN SATB1 TARGETS UP 395 249 All SZGR 2.0 genes in this pathway
CHIANG LIVER CANCER SUBCLASS CTNNB1 DN 170 105 All SZGR 2.0 genes in this pathway
HOSHIDA LIVER CANCER SUBCLASS S3 266 180 All SZGR 2.0 genes in this pathway
DANG REGULATED BY MYC DN 253 192 All SZGR 2.0 genes in this pathway
SENGUPTA EBNA1 ANTICORRELATED 173 85 All SZGR 2.0 genes in this pathway
SASSON RESPONSE TO GONADOTROPHINS DN 87 66 All SZGR 2.0 genes in this pathway
SASSON RESPONSE TO FORSKOLIN DN 88 68 All SZGR 2.0 genes in this pathway
金所有障碍OLIGODENDROCYTE NUMBER CORR UP 756 494 All SZGR 2.0 genes in this pathway
KIM BIPOLAR DISORDER OLIGODENDROCYTE DENSITY CORR UP 682 440 All SZGR 2.0 genes in this pathway
KIM ALL DISORDERS CALB1 CORR UP 548 370 All SZGR 2.0 genes in this pathway
LU EZH2 TARGETS DN 414 237 All SZGR 2.0 genes in this pathway
PILON KLF1 TARGETS DN 1972 1213 All SZGR 2.0 genes in this pathway
BRUINS UVC RESPONSE VIA TP53 GROUP D 280 158 All SZGR 2.0 genes in this pathway
PASINI SUZ12 TARGETS DN 315 215 All SZGR 2.0 genes in this pathway
KASLER HDAC7 TARGETS 1 UP 194 133 All SZGR 2.0 genes in this pathway
LEE BMP2 TARGETS UP 745 475 All SZGR 2.0 genes in this pathway
TORCHIA TARGETS OF EWSR1 FLI1 FUSION DN 321 200 All SZGR 2.0 genes in this pathway
GOBERT OLIGODENDROCYTE DIFFERENTIATION DN 1080 713 All SZGR 2.0 genes in this pathway

Section VI. microRNA annotation

miRNA family Target position miRNA ID miRNA seq
UTR start UTR end Match method
miR-138 2591 2597 1A hsa-miR-138brain AGCUGGUGUUGUGAAUC
miR-153 2490 2496 m8 hsa-miR-153 UUGCAUAGUCACAAAAGUGA
miR-493-5p 2407 2413 1A hsa-miR-493-5p UUGUACAUGGUAGGCUUUCAUU
miR-494 2352 2358 1A hsa-miR-494brain UGAAACAUACACGGGAAACCUCUU
miR-505 2536 2542 m8 hsa-miR-505 GUCAACACUUGCUGGUUUCCUC