Gene Page:PDE7B
Summary?
GeneID | 27115 |
Symbol | PDE7B |
Synonyms | bA472E5.1 |
Description | phosphodiesterase 7B |
Reference | MIM:604645|HGNC:HGNC:8792|Ensembl:ENSG00000171408|HPRD: 06870|Vega:OTTHUMG00000015641 |
Gene type | protein-coding |
Map location | 6q23-q24 |
Pascal p-value | 0.036 |
Fetal beta | -2.023 |
eGene | Myers' cis & trans |
Gene in Data Sources
Gene set name | Method of gene set | Description | Info |
---|---|---|---|
CV:GWASdb | Genome-wide Association Studies | GWASdb records for schizophrenia | |
CV:PGCnp | Genome-wide Association Study | GWAS | |
PMID:cooccur | High-throughput literature-search | Systematic search in PubMed for genes co-occurring with SCZ keywords. A total of 3027 genes were included. | |
Literature | High-throughput literature-search | Co-occurance with Schizophrenia keywords: schizophrenia,schizophrenic,schizophrenias | Click to show details |
GO_Annotation | Mapping neuro-related keywords to Gene Ontology annotations | Hits with neuro-related keywords: 1 |
Section I. Genetics and epigenetics annotation
eQTL annotation
SNP ID | Chromosome | Position | eGene | Gene Entrez ID | pvalue | qvalue | TSS distance | eQTL type |
---|---|---|---|---|---|---|---|---|
rs9389245 | chr6 | 135265648 | PDE7B | 27115 | 0.18 | cis |
Section II. Transcriptome annotation
General gene expression (GTEx)
![Not available](http://www.tjghsg.com/bioinfo/SZGR/GeneImg/PDE7B_DE_GTEx.png)
Gene expression during devlopment (BrainCloud)
Footnote:
A total of 269 time points ploted, with n=38 fetal samples (x=1:38). Each triangle represents one time point.
Gene expression of temporal and spatial changes (BrainSpan)
Footnote:
SC: sub-cortical regions; SM: sensory-motor regions; FC: frontal cortex; and TP: temporal-parietal cortex
ST1: fetal (13 - 26 postconception weeks), ST2: early infancy to late childhood (4 months to 11 years), and ST3: adolescence to adulthood (13 - 23 years)
The bar shown representes the lower 25% and upper 25% of the expression distribution.
No co-expressed genes in brain regions
Section III. Gene Ontology annotation
Molecular function | GO term | Evidence | Neuro keywords | PubMed ID |
---|---|---|---|---|
GO:0004115 | 3',5'-cyclic-AMP phosphodiesterase activity | TAS | 10618442 | |
GO:0016787 | hydrolase activity | IEA | - | |
Biological process | GO term | Evidence | Neuro keywords | PubMed ID |
GO:0007268 | synaptic transmission | TAS | neuron, Synap, Neurotransmitter (GO term level: 6) | 10814504 |
GO:0007165 | signal transduction | TAS | 10814504 |
Section V. Pathway annotation
Pathway name | Pathway size | # SZGR 2.0 genes in pathway | Info |
---|---|---|---|
KEGG PURINE METABOLISM | 159 | 96 | All SZGR 2.0 genes in this pathway |
REACTOME SIGNALING BY GPCR | 920 | 449 | All SZGR 2.0 genes in this pathway |
REACTOME GPCR DOWNSTREAM SIGNALING | 805 | 368 | All SZGR 2.0 genes in this pathway |
REACTOME G ALPHA S SIGNALLING EVENTS | 121 | 82 | All SZGR 2.0 genes in this pathway |
DEURIG T细胞PROLYMPHOCYTIC LEUKEMIA UP | 368 | 234 | All SZGR 2.0 genes in this pathway |
CHARAFE BREAST CANCER LUMINAL VS MESENCHYMAL DN | 460 | 312 | All SZGR 2.0 genes in this pathway |
DODD NASOPHARYNGEAL CARCINOMA UP | 1821 | 933 | All SZGR 2.0 genes in this pathway |
KANG GIST WITH PDGFRA UP | 50 | 27 | All SZGR 2.0 genes in this pathway |
WATTEL AUTONOMOUS THYROID ADENOMA UP | 73 | 47 | All SZGR 2.0 genes in this pathway |
MARSON BOUND BY FOXP3 UNSTIMULATED | 1229 | 713 | All SZGR 2.0 genes in this pathway |
RIGGI EWING SARCOMA PROGENITOR DN | 191 | 123 | All SZGR 2.0 genes in this pathway |
ZHENG IL22 SIGNALING DN | 42 | 26 | All SZGR 2.0 genes in this pathway |
GUO TARGETS OF IRS1 AND IRS2 | 98 | 67 | All SZGR 2.0 genes in this pathway |
ACEVEDO FGFR1 TARGETS IN PROSTATE CANCER MODEL UP | 289 | 184 | All SZGR 2.0 genes in this pathway |
ZWANG TRANSIENTLY UP BY 2ND EGF PULSE ONLY | 1725 | 838 | All SZGR 2.0 genes in this pathway |
Section VI. microRNA annotation
miRNA family | Target position | miRNA ID | miRNA seq | ||
---|---|---|---|---|---|
UTR start | UTR end | Match method | |||
miR-124.1 | 960 | 966 | 1A | hsa-miR-124a | UUAAGGCACGCGGUGAAUGCCA |
miR-128 | 869 | 876 | 1A,m8 | hsa-miR-128a | UCACAGUGAACCGGUCUCUUUU |
hsa-miR-128b | UCACAGUGAACCGGUCUCUUUC | ||||
miR-132/212 | 881 | 887 | 1A | hsa-miR-212SZ | UAACAGUCUCCAGUCACGGCC |
hsa-miR-132brain | UAACAGUCUACAGCCAUGGUCG | ||||
miR-135 | 175 | 181 | m8 | hsa-miR-135a | UAUGGCUUUUUAUUCCUAUGUGA |
hsa-miR-135b | UAUGGCUUUUCAUUCCUAUGUG | ||||
miR-138 | 403 | 410 | 1A,m8 | hsa-miR-138brain | AGCUGGUGUUGUGAAUC |
miR-144 | 879 | 885 | m8 | hsa-miR-144 | UACAGUAUAGAUGAUGUACUAG |
miR-182 | 821 | 827 | 1A | hsa-miR-182 | UUUGGCAAUGGUAGAACUCACA |
miR-19 | 724 | 730 | m8 | hsa-miR-19a | UGUGCAAAUCUAUGCAAAACUGA |
hsa-miR-19b | UGUGCAAAUCCAUGCAAAACUGA | ||||
miR-200bc/429 | 835 | 841 | 1A | hsa-miR-200b | UAAUACUGCCUGGUAAUGAUGAC |
hsa-miR-200c | UAAUACUGCCGGGUAAUGAUGG | ||||
hsa-miR-429 | UAAUACUGUCUGGUAAAACCGU | ||||
miR-218 | 448 | 454 | 1A | hsa-miR-218brain | UUGUGCUUGAUCUAACCAUGU |
miR-27 | 870 | 877 | 1A,m8 | hsa-miR-27abrain | UUCACAGUGGCUAAGUUCCGC |
hsa-miR-27bbrain | UUCACAGUGGCUAAGUUCUGC | ||||
miR-369-3p | 836 | 842 | m8 | hsa-miR-369-3p | AAUAAUACAUGGUUGAUCUUU |
hsa-miR-369-3p | AAUAAUACAUGGUUGAUCUUU | ||||
miR-374 | 498 | 505 | 1A,m8 | hsa-miR-374 | UUAUAAUACAACCUGAUAAGUG |
miR-9 | 1406 | 1412 | m8 | hsa-miR-9SZ | UCUUUGGUUAUCUAGCUGUAUGA |
miR-96 | 821 | 827 | 1A | hsa-miR-96brain | UUUGGCACUAGCACAUUUUUGC |
- SZ: miRNAs which differentially expressed in brain cortex of schizophrenia patients comparing with control samples using microarray. Clickhereto see the list of SZ related miRNAs.
- Brain: miRNAs which are expressed in brain based on miRNA microarray expression studies. Clickhereto see the list of brain related miRNAs.