Gene Page:GCLC
Summary?
GeneID | 2729 |
Symbol | GCLC |
Synonyms | GCL|GCS|GLCL|GLCLC |
Description | glutamate-cysteine ligase catalytic subunit |
Reference | MIM:606857|HGNC:HGNC:4311|Ensembl:ENSG00000001084|HPRD:06032|Vega:OTTHUMG00000160220 |
Gene type | protein-coding |
Map location | 6p12 |
Pascal p-value | 0.442 |
Sherlock p-value | 0.919 |
Fetal beta | -1.403 |
eGene | Cerebellum Cortex Hippocampus Myers' cis & trans |
Gene in Data Sources
Gene set name | Method of gene set | Description | Info |
---|---|---|---|
CV:PGCnp | Genome-wide Association Study | GWAS | |
PMID:cooccur | High-throughput literature-search | Systematic search in PubMed for genes co-occurring with SCZ keywords. A total of 3027 genes were included. | |
GSMA_IIE | Genome scan meta-analysis (European-ancestry samples) | Psr: 0.04433 | |
Literature | High-throughput literature-search | 与精神分裂症Co-occurance关键词:schizophrenia,schizophrenic,schizophrenias | Click to show details |
GO_Annotation | Mapping neuro-related keywords to Gene Ontology annotations | Hits with neuro-related keywords: 5 |
Section I. Genetics and epigenetics annotation
DNM table
Gene | Chromosome | Position | Ref | Alt | Transcript | AA change | Mutation type | Sift | CG46 | Trait | Study |
---|---|---|---|---|---|---|---|---|---|---|---|
GCLC | chr6 | 53387293 | T | C | NM_001197115 NM_001498 |
. . |
silent silent |
Schizophrenia | DNM:Gulsuner_2013 |
eQTL annotation
SNP ID | Chromosome | Position | eGene | Gene Entrez ID | pvalue | qvalue | TSS distance | eQTL type |
---|---|---|---|---|---|---|---|---|
rs6632306 | chrX | 35590460 | GCLC | 2729 | 0.07 | trans | ||
rs1935404 | chrX | 35605181 | GCLC | 2729 | 0.1 | trans |
Section II. Transcriptome annotation
General gene expression (GTEx)
![Not available](http://www.tjghsg.com/bioinfo/SZGR/GeneImg/GCLC_DE_GTEx.png)
Gene expression during devlopment (BrainCloud)
Footnote:
A total of 269 time points ploted, with n=38 fetal samples (x=1:38). Each triangle represents one time point.
Gene expression of temporal and spatial changes (BrainSpan)
Footnote:
SC: sub-cortical regions; SM: sensory-motor regions; FC: frontal cortex; and TP: temporal-parietal cortex
ST1: fetal (13 - 26 postconception weeks), ST2: early infancy to late childhood (4 months to 11 years), and ST3: adolescence to adulthood (13 - 23 years)
The bar shown representes the lower 25% and upper 25% of the expression distribution.
Top co-expressed genes in brain regions
Top 10 positively co-expressed genes | ||
Gene | 皮尔森的软木relation | Spearman's Correlation |
GLUD2 | 0.95 | 0.95 |
GPC5 | 0.91 | 0.88 |
SUCLG2 | 0.90 | 0.88 |
GJA1 | 0.90 | 0.86 |
S1PR1 | 0.89 | 0.81 |
PLSCR4 | 0.89 | 0.89 |
ITM2C | 0.87 | 0.88 |
ADD3 | 0.86 | 0.88 |
KCNJ16 | 0.86 | 0.83 |
NT5E | 0.85 | 0.86 |
Top 10 negatively co-expressed genes | ||
Gene | 皮尔森的软木relation | Spearman's Correlation |
RTF1 | -0.53 | -0.57 |
CCAR1 | -0.50 | -0.59 |
DPF1 | -0.49 | -0.48 |
MPP3 | -0.49 | -0.49 |
GMIP | -0.49 | -0.47 |
RP9 | -0.49 | -0.58 |
ZNF821 | -0.49 | -0.48 |
PHF14 | -0.49 | -0.56 |
AC011491.1 | -0.48 | -0.56 |
CHD3 | -0.48 | -0.47 |
Section III. Gene Ontology annotation
Molecular function | GO term | Evidence | Neuro keywords | PubMed ID |
---|---|---|---|---|
GO:0016595 | glutamate binding | IDA | glutamate (GO term level: 5) | 9841880 |
GO:0004357 | glutamate-cysteine ligase activity | IDA | glutamate (GO term level: 6) | 8104187|11972604 |
GO:0004357 | glutamate-cysteine ligase activity | IMP | glutamate (GO term level: 6) | 16183645 |
GO:0000287 | magnesium ion binding | IDA | 24639 | |
GO:0016874 | ligase activity | IEA | - | |
GO:0050662 | coenzyme binding | 新闻学会 | 9675072|9841880 | |
GO:0046982 | protein heterodimerization activity | IEA | - | |
GO:0043531 | ADP binding | IDA | 24639 | |
Biological process | GO term | Evidence | Neuro keywords | PubMed ID |
GO:0006536 | glutamate metabolic process | IDA | glutamate (GO term level: 8) | 2294991|12663448 |
GO:0006534 | cysteine metabolic process | IDA | 2294991 | |
GO:0019852 | L-ascorbic acid metabolic process | IEA | - | |
GO:0009410 | response to xenobiotic stimulus | IEA | - | |
GO:0009408 | response to heat | IDA | 8104187 | |
GO:0009725 | response to hormone stimulus | IDA | 8104187 | |
GO:0006750 | glutathione biosynthetic process | IDA | 8104187|10395918 | |
GO:0006750 | glutathione biosynthetic process | IMP | 12663448 | |
GO:0006979 | response to oxidative stress | IDA | 10395918|11972604 | |
GO:0006916 | anti-apoptosis | IDA | 10439045 | |
GO:0016481 | negative regulation of transcription | IDA | 10439045 | |
GO:0031397 | negative regulation of protein ubiquitination | IEA | - | |
GO:0032436 | positive regulation of proteasomal ubiquitin-dependent protein catabolic process | IEA | - | |
GO:0050880 | regulation of blood vessel size | IMP | 12598062 | |
GO:0046685 | response to arsenic | IEA | - | |
GO:0045454 | cell redox homeostasis | IDA | 10439045 | |
GO:0051900 | regulation of mitochondrial depolarization | IEA | - | |
Cellular component | GO term | Evidence | Neuro keywords | PubMed ID |
GO:0017109 | glutamate-cysteine ligase complex | IEA | glutamate (GO term level: 8) | - |
GO:0005829 | cytosol | IEA | - |
Section V. Pathway annotation
Pathway name | Pathway size | # SZGR 2.0 genes in pathway | Info |
---|---|---|---|
KEGG GLUTATHIONE METABOLISM | 50 | 34 | All SZGR 2.0 genes in this pathway |
REACTOME SULFUR AMINO ACID METABOLISM | 24 | 17 | All SZGR 2.0 genes in this pathway |
REACTOME METABOLISM OF AMINO ACIDS AND DERIVATIVES | 200 | 136 | All SZGR 2.0 genes in this pathway |
REACTOME BIOLOGICAL OXIDATIONS | 139 | 91 | All SZGR 2.0 genes in this pathway |
REACTOME GLUTATHIONE CONJUGATION | 23 | 13 | All SZGR 2.0 genes in this pathway |
REACTOME PHASE II CONJUGATION | 70 | 42 | All SZGR 2.0 genes in this pathway |
DIAZ CHRONIC MEYLOGENOUS LEUKEMIA UP | 1382 | 904 | All SZGR 2.0 genes in this pathway |
OSWALD HEMATOPOIETIC STEM CELL IN COLLAGEN GEL UP | 233 | 161 | All SZGR 2.0 genes in this pathway |
GARGALOVIC RESPONSE TO OXIDIZED PHOSPHOLIPIDS YELLOW UP | 32 | 25 | All SZGR 2.0 genes in this pathway |
MARKEY RB1 ACUTE LOF DN | 228 | 137 | All SZGR 2.0 genes in this pathway |
GRAESSMANN APOPTOSIS BY SERUM DEPRIVATION DN | 234 | 147 | All SZGR 2.0 genes in this pathway |
MCBRYAN PUBERTAL TGFB1 TARGETS DN | 62 | 44 | All SZGR 2.0 genes in this pathway |
BUYTAERT PHOTODYNAMIC THERAPY STRESS UP | 811 | 508 | All SZGR 2.0 genes in this pathway |
SCHAEFFER PROSTATE DEVELOPMENT 6HR UP | 176 | 115 | All SZGR 2.0 genes in this pathway |
SCHAEFFER PROSTATE DEVELOPMENT 48HR UP | 487 | 286 | All SZGR 2.0 genes in this pathway |
BENPORATH MYC MAX TARGETS | 775 | 494 | All SZGR 2.0 genes in this pathway |
ZHANG RESPONSE TO IKK INHIBITOR AND TNF UP | 223 | 140 | All SZGR 2.0 genes in this pathway |
MORI EMU MYC LYMPHOMA BY ONSET TIME UP | 110 | 69 | All SZGR 2.0 genes in this pathway |
ONDER CDH1 TARGETS 2 DN | 464 | 276 | All SZGR 2.0 genes in this pathway |
ONDER CDH1 TARGETS 1 UP | 140 | 85 | All SZGR 2.0 genes in this pathway |
UEDA PERIFERAL CLOCK | 169 | 111 | All SZGR 2.0 genes in this pathway |
SESTO RESPONSE TO UV C2 | 54 | 39 | All SZGR 2.0 genes in this pathway |
BLALOCK ALZHEIMERS DISEASE UP | 1691 | 1088 | All SZGR 2.0 genes in this pathway |
BROWNE HCMV INFECTION 14HR UP | 156 | 101 | All SZGR 2.0 genes in this pathway |
DAZARD RESPONSE TO UV NHEK DN | 318 | 220 | All SZGR 2.0 genes in this pathway |
MONNIER POSTRADIATION TUMOR ESCAPE UP | 393 | 244 | All SZGR 2.0 genes in this pathway |
SINGH NFE2L2 TARGETS | 15 | 12 | All SZGR 2.0 genes in this pathway |
KYNG DNA DAMAGE BY GAMMA AND UV RADIATION | 88 | 65 | All SZGR 2.0 genes in this pathway |
KYNG DNA DAMAGE UP | 226 | 164 | All SZGR 2.0 genes in this pathway |
MARTINEZ RB1 TARGETS UP | 673 | 430 | All SZGR 2.0 genes in this pathway |
MARTINEZ RB1 TARGETS DN | 543 | 317 | All SZGR 2.0 genes in this pathway |
MARTINEZ TP53 TARGETS DN | 593 | 372 | All SZGR 2.0 genes in this pathway |
MARTINEZ RB1 AND TP53 TARGETS DN | 591 | 366 | All SZGR 2.0 genes in this pathway |
ITO PTTG1 TARGETS UP | 12 | 9 | All SZGR 2.0 genes in this pathway |
GRADE COLON AND RECTAL CANCER UP | 285 | 167 | All SZGR 2.0 genes in this pathway |
LABBE TGFB1 TARGETS DN | 108 | 64 | All SZGR 2.0 genes in this pathway |
LABBE TARGETS OF TGFB1 AND WNT3A DN | 108 | 68 | All SZGR 2.0 genes in this pathway |
BOYAULT LIVER CANCER SUBCLASS G1 DN | 40 | 26 | All SZGR 2.0 genes in this pathway |
YAGI AML WITH 11Q23 REARRANGED | 351 | 238 | All SZGR 2.0 genes in this pathway |
FONTAINE FOLLICULAR THYROID ADENOMA UP | 75 | 43 | All SZGR 2.0 genes in this pathway |
GUTIERREZ CHRONIC LYMPHOCYTIC LEUKEMIA DN | 56 | 39 | All SZGR 2.0 genes in this pathway |
DANG BOUND BY MYC | 1103 | 714 | All SZGR 2.0 genes in this pathway |
FEVR CTNNB1 TARGETS UP | 682 | 433 | All SZGR 2.0 genes in this pathway |
IKEDA MIR1 TARGETS UP | 53 | 39 | All SZGR 2.0 genes in this pathway |
KRIEG HYPOXIA NOT VIA KDM3A | 770 | 480 | All SZGR 2.0 genes in this pathway |
FORTSCHEGGER PHF8 TARGETS UP | 279 | 155 | All SZGR 2.0 genes in this pathway |
ROESSLER LIVER CANCER METASTASIS UP | 107 | 72 | All SZGR 2.0 genes in this pathway |
ZWANG CLASS 1 TRANSIENTLY INDUCED BY EGF | 516 | 308 | All SZGR 2.0 genes in this pathway |
Section VI. microRNA annotation
miRNA family | 目标位置 | miRNA ID | miRNA seq | ||
---|---|---|---|---|---|
UTR start | UTR end | Match method | |||
miR-1/206 | 332 | 338 | 1A | hsa-miR-1 | UGGAAUGUAAAGAAGUAUGUA |
hsa-miR-206SZ | UGGAAUGUAAGGAAGUGUGUGG | ||||
hsa-miR-613 | AGGAAUGUUCCUUCUUUGCC | ||||
miR-18 | 519 | 526 | 1A,m8 | hsa-miR-18a | UAAGGUGCAUCUAGUGCAGAUA |
hsa-miR-18b | UAAGGUGCAUCUAGUGCAGUUA | ||||
miR-433-3p | 1002 | 1009 | 1A,m8 | hsa-miR-433brain | AUCAUGAUGGGCUCCUCGGUGU |
- SZ: miRNAs which differentially expressed in brain cortex of schizophrenia patients comparing with control samples using microarray. Clickhereto see the list of SZ related miRNAs.
- Brain: miRNAs which are expressed in brain based on miRNA microarray expression studies. Clickhereto see the list of brain related miRNAs.