Gene Page:KCNMB4
Summary?
GeneID | 27345 |
Symbol | KCNMB4 |
Synonyms | - |
Description | potassium calcium-activated channel subfamily M regulatory beta subunit 4 |
Reference | MIM:605223|HGNC:HGNC:6289|Ensembl:ENSG00000135643|HPRD:05564|Vega:OTTHUMG00000167586 |
Gene type | protein-coding |
Map location | 12q |
Pascal p-value | 0.004 |
Sherlock p-value | 0.311 |
eGene | Cerebellum |
Support | EXCITABILITY |
Gene in Data Sources
Gene set name | Method of gene set | Description | Info |
---|---|---|---|
CV:PGCnp | Genome-wide Association Study | GWAS | |
GO_Annotation | Mapping neuro-related keywords to Gene Ontology annotations | Hits with neuro-related keywords: 3 |
Section I. Genetics and epigenetics annotation
Section II. Transcriptome annotation
General gene expression (GTEx)
![Not available](http://www.tjghsg.com/bioinfo/SZGR/GeneImg/KCNMB4_DE_GTEx.png)
Gene expression of temporal and spatial changes (BrainSpan)
Footnote:
SC: sub-cortical regions; SM: sensory-motor regions; FC: frontal cortex; and TP: temporal-parietal cortex
死神:胎儿(13 - 26 postconception凌晨ks), ST2: early infancy to late childhood (4 months to 11 years), and ST3: adolescence to adulthood (13 - 23 years)
The bar shown representes the lower 25% and upper 25% of the expression distribution.
No co-expressed genes in brain regions
Section III. Gene Ontology annotation
Molecular function | 去的术语 | Evidence | Neuro keywords | PubMed ID |
---|---|---|---|---|
GO:0005515 | protein binding | 新闻学会 | 10692449 | |
GO:0005216 | ion channel activity | IEA | - | |
GO:0015269 | calcium-activated potassium channel activity | IDA | 10692449 | |
Biological process | 去的术语 | Evidence | Neuro keywords | PubMed ID |
GO:0046928 | regulation of neurotransmitter secretion | TAS | Synap, Neurotransmitter (GO term level: 9) | 10692449 |
GO:0007268 | synaptic transmission | TAS | neuron, Synap, Neurotransmitter (GO term level: 6) | 10692449 |
GO:0019228 | regulation of action potential in neuron | IDA | neuron (GO term level: 10) | 10692449 |
GO:0005513 | detection of calcium ion | IDA | 10692449 | |
GO:0006811 | ion transport | IEA | - | |
GO:0006813 | potassium ion transport | IDA | 10692449 | |
GO:0019229 | regulation of vasoconstriction | TAS | 10692449 | |
Cellular component | 去的术语 | Evidence | Neuro keywords | PubMed ID |
GO:0016020 | membrane | IEA | - | |
GO:0008076 | voltage-gated potassium channel complex | IDA | 10692449 |
Section V. Pathway annotation
Pathway name | Pathway size | # SZGR 2.0 genes in pathway | Info |
---|---|---|---|
KEGG VASCULAR SMOOTH MUSCLE CONTRACTION | 115 | 81 | All SZGR 2.0 genes in this pathway |
REACTOME NEURONAL SYSTEM | 279 | 221 | All SZGR 2.0 genes in this pathway |
REACTOME CGMP EFFECTS | 19 | 13 | All SZGR 2.0 genes in this pathway |
REACTOME NITRIC OXIDE STIMULATES GUANYLATE CYCLASE | 25 | 19 | All SZGR 2.0 genes in this pathway |
REACTOME PLATELET HOMEOSTASIS | 78 | 49 | All SZGR 2.0 genes in this pathway |
REACTOME HEMOSTASIS | 466 | 331 | All SZGR 2.0 genes in this pathway |
REACTOME POTASSIUM CHANNELS | 98 | 68 | All SZGR 2.0 genes in this pathway |
KINSEY TARGETS OF EWSR1 FLII FUSION DN | 329 | 219 | All SZGR 2.0 genes in this pathway |
COLDREN GEFITINIB RESISTANCE DN | 230 | 115 | All SZGR 2.0 genes in this pathway |
XU HGF TARGETS REPRESSED BY AKT1 DN | 95 | 58 | All SZGR 2.0 genes in this pathway |
GARCIA TARGETS OF FLI1 AND DAX1 UP | 57 | 34 | All SZGR 2.0 genes in this pathway |
SCHAEFFER PROSTATE DEVELOPMENT 48HR UP | 487 | 286 | All SZGR 2.0 genes in this pathway |
BENPORATH OCT4 TARGETS | 290 | 172 | All SZGR 2.0 genes in this pathway |
BENPORATH SOX2 TARGETS | 734 | 436 | All SZGR 2.0 genes in this pathway |
GEORGES TARGETS OF MIR192 AND MIR215 | 893 | 528 | All SZGR 2.0 genes in this pathway |
NIKOLSKY BREAST CANCER 12Q13 Q21 AMPLICON | 46 | 21 | All SZGR 2.0 genes in this pathway |
IVANOVA HEMATOPOIESIS STEM CELL | 254 | 164 | All SZGR 2.0 genes in this pathway |
BLALOCK ALZHEIMERS DISEASE UP | 1691 | 1088 | All SZGR 2.0 genes in this pathway |
CREIGHTON ENDOCRINE THERAPY RESISTANCE 4 | 307 | 185 | All SZGR 2.0 genes in this pathway |
BRUINS UVC RESPONSE VIA TP53 GROUP A | 898 | 516 | All SZGR 2.0 genes in this pathway |
PLASARI NFIC TARGETS BASAL UP | 27 | 17 | All SZGR 2.0 genes in this pathway |
PEDRIOLI MIR31 TARGETS DN | 418 | 245 | All SZGR 2.0 genes in this pathway |
Section VI. microRNA annotation
miRNA family | Target position | miRNA ID | miRNA seq | ||
---|---|---|---|---|---|
UTR start | UTR end | Match method | |||
miR-504 | 209 | 215 | 1A | hsa-miR-504 | AGACCCUGGUCUGCACUCUAU |
- SZ: miRNAs which differentially expressed in brain cortex of schizophrenia patients comparing with control samples using microarray. Clickhereto see the list of SZ related miRNAs.
- Brain: miRNAs which are expressed in brain based on miRNA microarray expression studies. Clickhereto see the list of brain related miRNAs.