Gene Page:GLRA2
Summary?
GeneID | 2742 |
Symbol | GLRA2 |
Synonyms | GLR |
Description | glycine receptor alpha 2 |
Reference | MIM:305990|HGNC:HGNC:4327|Ensembl:ENSG00000101958|HPRD:02379|Vega:OTTHUMG00000021166 |
Gene type | protein-coding |
Map location | Xp22.2 |
Fetal beta | 3.12 |
Support | Potential synaptic genes |
Gene in Data Sources
Gene set name | Method of gene set | Description | Info |
---|---|---|---|
CV:PGCnp | Genome-wide Association Study | GWAS | |
PMID:cooccur | High-throughput literature-search | 系统搜索PubMed co-o基因ccurring with SCZ keywords. A total of 3027 genes were included. | |
Literature | High-throughput literature-search | Co-occurance with Schizophrenia keywords: schizophrenia,schizophrenias | Click to show details |
GO_Annotation | Mapping neuro-related keywords to Gene Ontology annotations | Hits with neuro-related keywords: 4 |
Section I. Genetics and epigenetics annotation
Section II. Transcriptome annotation
General gene expression (GTEx)
![Not available](http://www.tjghsg.com/bioinfo/SZGR/GeneImg/GLRA2_DE_GTEx.png)
Gene expression during devlopment (BrainCloud)
Footnote:
A total of 269 time points ploted, with n=38 fetal samples (x=1:38). Each triangle represents one time point.
Gene expression of temporal and spatial changes (BrainSpan)
Footnote:
SC: sub-cortical regions; SM: sensory-motor regions; FC: frontal cortex; and TP: temporal-parietal cortex
ST1: fetal (13 - 26 postconception weeks), ST2: early infancy to late childhood (4 months to 11 years), and ST3: adolescence to adulthood (13 - 23 years)
The bar shown representes the lower 25% and upper 25% of the expression distribution.
No co-expressed genes in brain regions
Section III. Gene Ontology annotation
Molecular function | 去的术语 | Evidence | Neuro keywords | PubMed ID |
---|---|---|---|---|
GO:0030594 | neurotransmitter receptor activity | IEA | Neurotransmitter (GO term level: 5) | - |
GO:0004890 | GABA-A receptor activity | IEA | GABA (GO term level: 7) | - |
GO:0004891 | glycine-inhibited chloride channel activity | TAS | 2155780 | |
GO:0005216 | ion channel activity | IEA | - | |
GO:0005230 | extracellular ligand-gated ion channel activity | IEA | - | |
GO:0016934 | extracellular-glycine-gated chloride channel activity | IDA | 2155780 | |
GO:0016594 | glycine binding | IDA | 2155780 | |
GO:0031404 | chloride ion binding | IEA | - | |
Biological process | 去的术语 | Evidence | Neuro keywords | PubMed ID |
GO:0007218 | neuropeptide signaling pathway | IDA | Neurotransmitter (GO term level: 8) | 2155780 |
GO:0006821 | chloride transport | IEA | - | |
GO:0006811 | ion transport | IDA | 2155780 | |
Cellular component | 去的术语 | Evidence | Neuro keywords | PubMed ID |
GO:0045211 | postsynaptic membrane | IEA | Synap, Neurotransmitter (GO term level: 5) | - |
GO:0045202 | synapse | IEA | neuron, Synap, Neurotransmitter, Glial (GO term level: 2) | - |
GO:0005886 | plasma membrane | IEA | - | |
GO:0005887 | integral to plasma membrane | NAS | 2155780 | |
GO:0030054 | cell junction | IEA | - |
Section V. Pathway annotation
Pathway name | Pathway size | # SZGR 2.0 genes in pathway | Info |
---|---|---|---|
KEGG NEUROACTIVE LIGAND RECEPTOR INTERACTION | 272 | 195 | All SZGR 2.0 genes in this pathway |
REACTOME TRANSMEMBRANE TRANSPORT OF SMALL MOLECULES | 413 | 270 | All SZGR 2.0 genes in this pathway |
REACTOME ION CHANNEL TRANSPORT | 55 | 42 | All SZGR 2.0 genes in this pathway |
REACTOME LIGAND GATED ION CHANNEL TRANSPORT | 21 | 21 | All SZGR 2.0 genes in this pathway |
GAL LEUKEMIC STEM CELL UP | 133 | 78 | All SZGR 2.0 genes in this pathway |
PUJANA BRCA2 PCC NETWORK | 423 | 265 | All SZGR 2.0 genes in this pathway |
HASLINGER B CLL WITH 11Q23 DELETION | 23 | 18 | All SZGR 2.0 genes in this pathway |
KAYO AGING MUSCLE UP | 244 | 165 | All SZGR 2.0 genes in this pathway |
LEIN MIDBRAIN MARKERS | 82 | 55 | All SZGR 2.0 genes in this pathway |
LEIN PONS MARKERS | 89 | 59 | All SZGR 2.0 genes in this pathway |
HOSHIDA LIVER CANCER LATE RECURRENCE DN | 69 | 48 | All SZGR 2.0 genes in this pathway |
DELACROIX RAR BOUND ES | 462 | 273 | All SZGR 2.0 genes in this pathway |
ZWANG CLASS 1 TRANSIENTLY INDUCED BY EGF | 516 | 308 | All SZGR 2.0 genes in this pathway |
Section VI. microRNA annotation
miRNA family | Target position | miRNA ID | miRNA seq | ||
---|---|---|---|---|---|
UTR start | UTR end | Match method | |||
miR-101 | 1096 | 1102 | m8 | hsa-miR-101 | UACAGUACUGUGAUAACUGAAG |
miR-103/107 | 527 | 533 | m8 | hsa-miR-103brain | AGCAGCAUUGUACAGGGCUAUGA |
hsa-miR-107brain | AGCAGCAUUGUACAGGGCUAUCA | ||||
miR-128 | 1098 | 1104 | 1A | hsa-miR-128a | UCACAGUGAACCGGUCUCUUUU |
hsa-miR-128b | UCACAGUGAACCGGUCUCUUUC | ||||
miR-133 | 506 | 512 | 1A | hsa-miR-133a | UUGGUCCCCUUCAACCAGCUGU |
hsa-miR-133b | UUGGUCCCCUUCAACCAGCUA | ||||
miR-136 | 919 | 925 | 1A | hsa-miR-136 | ACUCCAUUUGUUUUGAUGAUGGA |
miR-142-5p | 68 | 74 | 1A | hsa-miR-142-5p | CAUAAAGUAGAAAGCACUAC |
miR-200bc/429 | 911 | 917 | m8 | hsa-miR-200b | UAAUACUGCCUGGUAAUGAUGAC |
hsa-miR-200c | UAAUACUGCCGGGUAAUGAUGG | ||||
hsa-miR-429 | UAAUACUGUCUGGUAAAACCGU | ||||
miR-224 | 863 | 869 | m8 | hsa-miR-224 | CAAGUCACUAGUGGUUCCGUUUA |
miR-27 | 1098 | 1104 | m8 | hsa-miR-27abrain | UUCACAGUGGCUAAGUUCCGC |
hsa-miR-27bbrain | UUCACAGUGGCUAAGUUCUGC | ||||
miR-325 | 995 | 1001 | m8 | hsa-miR-325 | CCUAGUAGGUGUCCAGUAAGUGU |
miR-329 | 927 | 933 | m8 | hsa-miR-329brain | AACACACCUGGUUAACCUCUUU |
miR-378 | 519 | 525 | 1A | hsa-miR-378 | CUCCUGACUCCAGGUCCUGUGU |
miR-494 | 588 | 594 | 1A | hsa-miR-494brain | UGAAACAUACACGGGAAACCUCUU |
miR-544 | 203 | 209 | m8 | hsa-miR-544 | AUUCUGCAUUUUUAGCAAGU |
- SZ: miRNAs which differentially expressed in brain cortex of schizophrenia patients comparing with control samples using microarray. Clickhereto see the list of SZ related miRNAs.
- Brain: miRNAs which are expressed in brain based on miRNA microarray expression studies. Clickhereto see the list of brain related miRNAs.