Gene Page:EML4
Summary?
GeneID | 27436 |
Symbol | EML4 |
Synonyms | C2orf2|ELP120|EMAP-4|EMAPL4|ROPP120 |
Description | echinoderm microtubule associated protein like 4 |
Reference | MIM:607442|HGNC:HGNC:1316|运用:ENSG00000143924|HPRD:06310|Vega:OTTHUMG00000128603 |
Gene type | protein-coding |
Map location | 2p21 |
Pascal p-value | 0.505 |
Sherlock p-value | 0.925 |
Fetal beta | 1.591 |
DMG | 1 (# studies) |
eGene | Myers' cis & trans |
Gene in Data Sources
Gene set name | Method of gene set | Description | Info |
---|---|---|---|
CV:PGCnp | Genome-wide Association Study | GWAS | |
DMG:Wockner_2014 | Genome-wide DNA methylation analysis | This dataset includes 4641 differentially methylated probes corresponding to 2929 unique genes between schizophrenia patients (n=24) and controls (n=24). | 1 |
GO_Annotation | Mapping neuro-related keywords to Gene Ontology annotations | Hits with neuro-related keywords: 1 |
Section I. Genetics and epigenetics annotation
Differentially methylated gene
Probe | Chromosome | Position | Nearest gene | P (dis) | Beta (dis) | FDR (dis) | Study |
---|---|---|---|---|---|---|---|
cg04741211 | 2 | 42399049 | EML4 | 4.429E-4 | 0.483 | 0.045 | DMG:Wockner_2014 |
eQTL annotation
SNP ID | Chromosome | Position | eGene | Gene Entrez ID | pvalue | qvalue | TSS distance | eQTL type |
---|---|---|---|---|---|---|---|---|
rs7524946 | chr1 | 101604780 | EML4 | 27436 | 0.13 | trans | ||
rs17450806 | chr1 | 101605108 | EML4 | 27436 | 0.06 | trans | ||
rs12219173 | chr10 | 68689566 | EML4 | 27436 | 0.11 | trans |
Section II. Transcriptome annotation
General gene expression (GTEx)
![Not available](http://www.tjghsg.com/bioinfo/SZGR/GeneImg/EML4_DE_GTEx.png)
Gene expression during devlopment (BrainCloud)
补充说明:
A total of 269 time points ploted, with n=38 fetal samples (x=1:38). Each triangle represents one time point.
Gene expression of temporal and spatial changes (BrainSpan)
补充说明:
SC: sub-cortical regions; SM: sensory-motor regions; FC: frontal cortex; and TP: temporal-parietal cortex
死神:胎儿(13- 26 postconception weeks), ST2: early infancy to late childhood (4 months to 11 years), and ST3: adolescence to adulthood (13 - 23 years)
The bar shown representes the lower 25% and upper 25% of the expression distribution.
No co-expressed genes in brain regions
Section III. Gene Ontology annotation
Molecular function | 去的术语 | Evidence | Neuro keywords | PubMed ID |
---|---|---|---|---|
GO:0004252 | serine-type endopeptidase activity | IEA | glutamate (GO term level: 7) | - |
GO:0003993 | acid phosphatase activity | IEA | - | |
GO:0003674 | molecular_function | ND | - | |
GO:0005509 | calcium ion binding | IEA | - | |
GO:0005515 | protein binding | 新闻学会 | 17353931 | |
生物过程 | 去的术语 | Evidence | Neuro keywords | PubMed ID |
GO:0006508 | proteolysis | IEA | - | |
GO:0007067 | mitosis | NAS | 10995578 | |
GO:0007017 | microtubule-based process | NAS | 10995578 | |
Cellular component | 去的术语 | Evidence | Neuro keywords | PubMed ID |
GO:0005874 | microtubule | IEA | - | |
GO:0005737 | cytoplasm | NAS | 10995578 |
Section V. Pathway annotation
Pathway name | Pathway size | # SZGR 2.0 genes in pathway | Info |
---|---|---|---|
FULCHER INFLAMMATORY RESPONSE LECTIN VS LPS UP | 579 | 346 | All SZGR 2.0 genes in this pathway |
DEURIG T CELL PROLYMPHOCYTIC LEUKEMIA DN | 320 | 184 | All SZGR 2.0 genes in this pathway |
VECCHI GASTRIC CANCER EARLY UP | 430 | 232 | All SZGR 2.0 genes in this pathway |
UDAYAKUMAR MED1 TARGETS UP | 135 | 82 | All SZGR 2.0 genes in this pathway |
VANHARANTA UTERINE FIBROID WITH 7Q DELETION DN | 36 | 23 | All SZGR 2.0 genes in this pathway |
DARWICHE SKIN TUMOR PROMOTER UP | 142 | 96 | All SZGR 2.0 genes in this pathway |
DARWICHE PAPILLOMA RISK LOW DN | 165 | 107 | All SZGR 2.0 genes in this pathway |
DARWICHE PAPILLOMA RISK HIGH UP | 147 | 101 | All SZGR 2.0 genes in this pathway |
DARWICHE SQUAMOUS CELL CARCINOMA DN | 181 | 107 | All SZGR 2.0 genes in this pathway |
DARWICHE PAPILLOMA RISK HIGH VS LOW UP | 6 | 6 | All SZGR 2.0 genes in this pathway |
BUYTAERT PHOTODYNAMIC THERAPY STRESS DN | 637 | 377 | All SZGR 2.0 genes in this pathway |
RICKMAN TUMOR DIFFERENTIATED WELL VS POORLY UP | 236 | 139 | All SZGR 2.0 genes in this pathway |
RICKMAN TUMOR DIFFERENTIATED WELL VS MODERATELY UP | 109 | 69 | All SZGR 2.0 genes in this pathway |
SCHAEFFER PROSTATE DEVELOPMENT 6HR DN | 514 | 330 | All SZGR 2.0 genes in this pathway |
ONDER CDH1 TARGETS 1 DN | 169 | 102 | All SZGR 2.0 genes in this pathway |
RADMACHER AML PROGNOSIS | 78 | 52 | All SZGR 2.0 genes in this pathway |
IVANOVA HEMATOPOIESIS STEM CELL LONG TERM | 302 | 191 | All SZGR 2.0 genes in this pathway |
MARTINEZ RESPONSE TO TRABECTEDIN DN | 271 | 175 | All SZGR 2.0 genes in this pathway |
CREIGHTON ENDOCRINE THERAPY RESISTANCE 3 | 720 | 440 | All SZGR 2.0 genes in this pathway |
MARSON BOUND BY FOXP3 STIMULATED | 1022 | 619 | All SZGR 2.0 genes in this pathway |
KYNG DNA DAMAGE BY GAMMA AND UV RADIATION | 88 | 65 | All SZGR 2.0 genes in this pathway |
KYNG DNA DAMAGE UP | 226 | 164 | All SZGR 2.0 genes in this pathway |
ACEVEDO NORMAL TISSUE ADJACENT TO LIVER TUMOR DN | 354 | 216 | All SZGR 2.0 genes in this pathway |
VANTVEER BREAST CANCER ESR1 DN | 240 | 153 | All SZGR 2.0 genes in this pathway |
VANTVEER BREAST CANCER BRCA1 UP | 36 | 18 | All SZGR 2.0 genes in this pathway |
BOYAULT LIVER CANCER SUBCLASS G3 UP | 188 | 121 | All SZGR 2.0 genes in this pathway |
CHANDRAN METASTASIS UP | 221 | 135 | All SZGR 2.0 genes in this pathway |
WAKABAYASHI ADIPOGENESIS PPARG BOUND 8D | 658 | 397 | All SZGR 2.0 genes in this pathway |
Section VI. microRNA annotation
miRNA family | Target position | miRNA ID | miRNA seq | ||
---|---|---|---|---|---|
UTR start | UTR end | Match method | |||
miR-1/206 | 1439 | 1445 | 1A | hsa-miR-1 | UGGAAUGUAAAGAAGUAUGUA |
hsa-miR-206SZ | UGGAAUGUAAGGAAGUGUGUGG | ||||
hsa-miR-613 | AGGAAUGUUCCUUCUUUGCC | ||||
miR-134 | 1054 | 1061 | 1A,m8 | hsa-miR-134brain | UGUGACUGGUUGACCAGAGGG |
miR-142-3p | 572 | 578 | m8 | hsa-miR-142-3p | UGUAGUGUUUCCUACUUUAUGGA |
hsa-miR-142-3p | UGUAGUGUUUCCUACUUUAUGGA | ||||
miR-145 | 283 | 289 | 1A | hsa-miR-145 | GUCCAGUUUUCCCAGGAAUCCCUU |
miR-183 | 1435 | 1441 | m8 | hsa-miR-183 | UAUGGCACUGGUAGAAUUCACUG |
miR-208 | 1406 | 1412 | 1A | hsa-miR-208 | AUAAGACGAGCAAAAAGCUUGU |
miR-216 | 2042 | 2048 | m8 | hsa-miR-216 | UAAUCUCAGCUGGCAACUGUG |
miR-24 | 2254 | 2260 | 1A | hsa-miR-24SZ | UGGCUCAGUUCAGCAGGAACAG |
miR-29 | 950 | 956 | m8 | hsa-miR-29aSZ | UAGCACCAUCUGAAAUCGGUU |
hsa-miR-29bSZ | UAGCACCAUUUGAAAUCAGUGUU | ||||
hsa-miR-29cSZ | UAGCACCAUUUGAAAUCGGU | ||||
miR-30-5p | 1715 | 1722 | 1A,m8 | hsa-miR-30a-5p | UGUAAACAUCCUCGACUGGAAG |
hsa-miR-30cbrain | UGUAAACAUCCUACACUCUCAGC | ||||
hsa-miR-30dSZ | UGUAAACAUCCCCGACUGGAAG | ||||
hsa-miR-30bSZ | UGUAAACAUCCUACACUCAGCU | ||||
hsa-miR-30e-5p | UGUAAACAUCCUUGACUGGA | ||||
miR-494 | 2236 | 2242 | 1A | hsa-miR-494brain | UGAAACAUACACGGGAAACCUCUU |
miR-495 | 704 | 711 | 1A,m8 | hsa-miR-495brain | AAACAAACAUGGUGCACUUCUUU |
miR-499 | 1405 | 1412 | 1A,m8 | hsa-miR-499 | UUAAGACUUGCAGUGAUGUUUAA |
miR-544 | 2287 | 2293 | 1A | hsa-miR-544 | AUUCUGCAUUUUUAGCAAGU |
- SZ: miRNAs which differentially expressed in brain cortex of schizophrenia patients comparing with control samples using microarray. Clickhereto see the list of SZ related miRNAs.
- Brain: miRNAs which are expressed in brain based on miRNA microarray expression studies. Clickhereto see the list of brain related miRNAs.