Gene Page:GNL1

Summary?
GeneID 2794
Symbol GNL1
Synonyms HSR1
Description G protein nucleolar 1 (putative)
Reference MIM:143024|HGNC:HGNC:4413|Ensembl:ENSG00000204590|HPRD:00879|Vega:OTTHUMG00000031137
Gene type protein-coding
Map location 6p21.3
Pascal p-value 2.098E-14
Fetal beta -0.09
DMG 1 (# studies)
eGene 元
Support CompositeSet

Gene in Data Sources
Gene set name Method of gene set Description Info
CV:GWASdb Genome-wide Association Studies GWASdb records for schizophrenia
CV:PGCnp Genome-wide Association Study GWAS
DMG:Jaffe_2016 Genome-wide DNA methylation analysis This dataset includes 2,104 probes/CpGs associated with SZ patients (n=108) compared to 136 controls at Bonferroni-adjusted P < 0.05. 2
DMG:Wockner_2014 Genome-wide DNA methylation analysis This dataset includes 4641 differentially methylated probes corresponding to 2929 unique genes between schizophrenia patients (n=24) and controls (n=24). 2
GSMA_I Genome scan meta-analysis Psr: 0.033

Section I. Genetics and epigenetics annotation

@Differentially methylated gene

Probe Chromosome Position Nearest gene P (dis) Beta (dis) FDR (dis) Study
cg23654545 6 30525120 PRR3;GNL1 3.853E-4 -0.207 0.043 DMG:Wockner_2014
cg14284643 6 30524853 GNL1 1.83E-9 -0.02 1.57E-6 DMG:Jaffe_2016


Section II. Transcriptome annotation

General gene expression (GTEx)

Not available

Gene expression during devlopment (BrainCloud)

Footnote:
A total of 269 time points ploted, with n=38 fetal samples (x=1:38). Each triangle represents one time point.

Gene expression of temporal and spatial changes (BrainSpan)

Footnote:
SC: sub-cortical regions; SM: sensory-motor regions; FC: frontal cortex; and TP: temporal-parietal cortex
死神:胎儿(13 - 26 postconception我们eks), ST2: early infancy to late childhood (4 months to 11 years), and ST3: adolescence to adulthood (13 - 23 years)
The bar shown representes the lower 25% and upper 25% of the expression distribution.

Top co-expressed genes in brain regions

Top 10 positively co-expressed genes
Gene Pearson's Correlation Spearman's Correlation
AC087749.2 0.70 0.71
MYO15B 0.64 0.71
C9orf131 0.62 0.65
AC103810.3 0.62 0.66
C10orf108 0.60 0.53
SLC34A3 0.60 0.58
MALAT1 0.59 0.61
ARHGEF1 0.59 0.67
AP000769.2 0.59 0.61
ZBTB32 0.58 0.53
Top 10 negatively co-expressed genes
Gene Pearson's Correlation Spearman's Correlation
TMEM70 -0.49 -0.51
CAPZA2 -0.48 -0.50
C18orf32 -0.47 -0.58
BRP44 -0.47 -0.51
COMMD10 -0.47 -0.52
UQCRFSL1 -0.46 -0.49
TMEM126A -0.46 -0.53
MRPL15 -0.45 -0.47
COX5A -0.44 -0.49
NDUFAB1 -0.44 -0.45

Section III. Gene Ontology annotation

Molecular function 去的术语 Evidence Neuro keywords PubMed ID
GO:0000166 nucleotide binding IEA -
GO:0005525 GTP binding IEA -
GO:0005525 GTP binding NAS 8180467
GO:0005198 structural molecule activity NAS 8180467
Biological process 去的术语 Evidence Neuro keywords PubMed ID
GO:0002456 T cell mediated immunity NAS 8180467
GO:0007165 signal transduction NAS 8180467
GO:0006974 response to DNA damage stimulus IDA 17525332
Cellular component 去的术语 Evidence Neuro keywords PubMed ID
GO:0005615 extracellular space NAS 8180467
GO:0005622 intracellular IEA -

Section V. Pathway annotation

Pathway name Pathway size # SZGR 2.0 genes in pathway Info
GRAESSMANN APOPTOSIS BY DOXORUBICIN DN 1781 1082 All SZGR 2.0 genes in this pathway
GRAESSMANN RESPONSE TO MC AND DOXORUBICIN DN 770 415 All SZGR 2.0 genes in this pathway
DACOSTA UV RESPONSE VIA ERCC3 TTD UP 64 39 All SZGR 2.0 genes in this pathway
DACOSTA UV RESPONSE VIA ERCC3 UP 309 199 All SZGR 2.0 genes in this pathway
SPIELMAN LYMPHOBLAST EUROPEAN VS ASIAN UP 479 299 All SZGR 2.0 genes in this pathway
NUYTTEN EZH2 TARGETS DN 1024 594 All SZGR 2.0 genes in this pathway
BENPORATH MYC MAX TARGETS 775 494 All SZGR 2.0 genes in this pathway
THEILGAARD NEUTROPHIL AT SKIN WOUND UP 77 52 All SZGR 2.0 genes in this pathway
BROWNE HCMV INFECTION 20HR UP 240 152 All SZGR 2.0 genes in this pathway
IVANOVA HEMATOPOIESIS STEM CELL 254 164 All SZGR 2.0 genes in this pathway
BROWNE HCMV INFECTION 10HR UP 101 69 All SZGR 2.0 genes in this pathway
KAYO CALORIE RESTRICTION MUSCLE UP 95 64 All SZGR 2.0 genes in this pathway
KRIGE RESPONSE TO TOSEDOSTAT 6HR UP 953 554 All SZGR 2.0 genes in this pathway
KRIGE RESPONSE TO TOSEDOSTAT 24HR UP 783 442 All SZGR 2.0 genes in this pathway
DANG BOUND BY MYC 1103 714 All SZGR 2.0 genes in this pathway
GOBERT OLIGODENDROCYTE DIFFERENTIATION UP 570 339 All SZGR 2.0 genes in this pathway
FORTSCHEGGER PHF8 TARGETS DN 784 464 All SZGR 2.0 genes in this pathway

Section VI. microRNA annotation

miRNA family Target position miRNA ID miRNA seq
UTR start UTR end Match method
miR-330 100 106 m8 hsa-miR-330brain GCAAAGCACACGGCCUGCAGAGA