Gene Page:GPX3
Summary?
GeneID | 2878 |
Symbol | GPX3 |
Synonyms | GPx-P|GSHPx-3|GSHPx-P |
Description | glutathione peroxidase 3 |
Reference | MIM:138321|HGNC:HGNC:4555|Ensembl:ENSG00000211445|HPRD:11750|Vega:OTTHUMG00000163693 |
Gene type | protein-coding |
Map location | 5q33.1 |
Pascal p-value | 0.22 |
Sherlock p-value | 0.497 |
Fetal beta | -0.486 |
eGene | Myers' cis & trans Meta |
Gene in Data Sources
Gene set name | Method of gene set | Description | Info |
---|---|---|---|
CV:GWASdb | Genome-wide Association Studies | GWASdb records for schizophrenia | |
CV:PGCnp | Genome-wide Association Study | GWAS | |
PMID:cooccur | High-throughput literature-search | Systematic search in PubMed for genes co-occurring with SCZ keywords. A total of 3027 genes were included. | |
GSMA_I | Genome scan meta-analysis | Psr: 0.0032 | |
GSMA_IIE | Genome scan meta-analysis (European-ancestry samples) | Psr: 0.01718 | |
GSMA_IIA | 基因组扫描荟萃分析(所有样品) | Psr: 0.00459 | |
Literature | High-throughput literature-search | 与精神分裂症Co-occurance关键词:schizophrenia,schizophrenic,schizophrenias | Click to show details |
Section I. Genetics and epigenetics annotation
eQTL annotation
SNP ID | Chromosome | Position | eGene | Gene Entrez ID | pvalue | qvalue | TSS distance | eQTL type |
---|---|---|---|---|---|---|---|---|
rs10484691 | chr6 | 62444039 | GPX3 | 2878 | 0.08 | trans | ||
rs7011197 | chr8 | 54240481 | GPX3 | 2878 | 0.14 | trans | ||
rs7816572 | chr8 | 54265565 | GPX3 | 2878 | 0.17 | trans | ||
rs1872761 | chr15 | 40003815 | GPX3 | 2878 | 0.1 | trans | ||
snp_a-1955963 | 0 | GPX3 | 2878 | 7.33E-4 | trans | |||
rs9952767 | chr18 | 7350414 | GPX3 | 2878 | 0.15 | trans | ||
rs9304098 | chr18 | 29083629 | GPX3 | 2878 | 0.15 | trans | ||
rs2704052 | chr18 | 29095433 | GPX3 | 2878 | 0.12 | trans | ||
rs7065377 | chrX | 65081776 | GPX3 | 2878 | 0.1 | trans | ||
rs6624825 | chrX | 65094493 | GPX3 | 2878 | 0.1 | trans |
Section II. Transcriptome annotation
General gene expression (GTEx)
![Not available](http://www.tjghsg.com/bioinfo/SZGR/GeneImg/GPX3_DE_GTEx.png)
Gene expression during devlopment (BrainCloud)
Footnote:
A total of 269 time points ploted, with n=38 fetal samples (x=1:38). Each triangle represents one time point.
Gene expression of temporal and spatial changes (BrainSpan)
Footnote:
SC: sub-cortical regions; SM: sensory-motor regions; FC: frontal cortex; and TP: temporal-parietal cortex
ST1: fetal (13 - 26 postconception weeks), ST2: early infancy to late childhood (4 months to 11 years), and ST3: adolescence to adulthood (13 - 23 years)
The bar shown representes the lower 25% and upper 25% of the expression distribution.
Top co-expressed genes in brain regions
Top 10 positively co-expressed genes | ||
Gene | Pearson's Correlation | Spearman's Correlation |
FNDC3A | 0.74 | 0.84 |
KCTD3 | 0.73 | 0.78 |
AGL | 0.73 | 0.81 |
WDR44 | 0.72 | 0.81 |
BRWD2 | 0.71 | 0.78 |
SH3GLB1 | 0.71 | 0.76 |
ASCC3 | 0.71 | 0.81 |
SEMA6D | 0.71 | 0.77 |
ZMYND11 | 0.71 | 0.80 |
HMGCS1 | 0.70 | 0.77 |
Top 10 negatively co-expressed genes | ||
Gene | Pearson's Correlation | Spearman's Correlation |
MT-CO2 | -0.55 | -0.66 |
FXYD1 | -0.54 | -0.64 |
MYL3 | -0.54 | -0.66 |
AF347015.31 | -0.52 | -0.62 |
COPZ2 | -0.51 | -0.58 |
AF347015.33 | -0.51 | -0.60 |
AF347015.8 | -0.51 | -0.62 |
AF347015.21 | -0.50 | -0.62 |
AF347015.27 | -0.49 | -0.60 |
HIGD1B | -0.49 | -0.63 |
Section III. Gene Ontology annotation
Molecular function | GO term | Evidence | Neuro keywords | PubMed ID |
---|---|---|---|---|
GO:0004602 | glutathione peroxidase activity | IDA | 1897960|3693360 | |
GO:0008430 | selenium binding | IDA | 2491950|3693360 | |
GO:0008134 | transcription factor binding | TAS | 8056346 | |
GO:0016491 | oxidoreductase activity | IEA | - | |
Biological process | GO term | Evidence | Neuro keywords | PubMed ID |
GO:0006982 | response to lipid hydroperoxide | TAS | 2491950 | |
GO:0006979 | response to oxidative stress | IEA | - | |
GO:0051289 | protein homotetramerization | IDA | 3693360 | |
GO:0042744 | hydrogen peroxide catabolic process | TAS | 2491950 | |
GO:0055114 | oxidation reduction | IEA | - | |
Cellular component | GO term | Evidence | Neuro keywords | PubMed ID |
GO:0005576 | extracellular region | IEA | - | |
GO:0005615 | extracellular space | IDA | 1897960 |
Section V. Pathway annotation
Pathway name | Pathway size | # SZGR 2.0 genes in pathway | Info |
---|---|---|---|
KEGG GLUTATHIONE METABOLISM | 50 | 34 | All SZGR 2.0 genes in this pathway |
KEGG ARACHIDONIC ACID METABOLISM | 58 | 36 | All SZGR 2.0 genes in this pathway |
FULCHER INFLAMMATORY RESPONSE LECTIN VS LPS DN | 463 | 290 | All SZGR 2.0 genes in this pathway |
DIAZ CHRONIC MEYLOGENOUS LEUKEMIA DN | 116 | 79 | All SZGR 2.0 genes in this pathway |
VECCHI GASTRIC CANCER EARLY DN | 367 | 220 | All SZGR 2.0 genes in this pathway |
SENESE HDAC3 TARGETS DN | 536 | 332 | All SZGR 2.0 genes in this pathway |
SABATES COLORECTAL ADENOMA DN | 291 | 176 | All SZGR 2.0 genes in this pathway |
RODRIGUES THYROID CARCINOMA POORLY DIFFERENTIATED DN | 805 | 505 | All SZGR 2.0 genes in this pathway |
RODRIGUES THYROID CARCINOMA ANAPLASTIC DN | 537 | 339 | All SZGR 2.0 genes in this pathway |
KOKKINAKIS METHIONINE DEPRIVATION 48HR UP | 128 | 95 | All SZGR 2.0 genes in this pathway |
KOKKINAKIS METHIONINE DEPRIVATION 96HR UP | 117 | 84 | All SZGR 2.0 genes in this pathway |
LINDGREN BLADDER CANCER CLUSTER 1 DN | 378 | 231 | All SZGR 2.0 genes in this pathway |
LANDIS ERBB2 BREAST TUMORS 65 DN | 37 | 22 | All SZGR 2.0 genes in this pathway |
LANDIS ERBB2 BREAST PRENEOPLASTIC DN | 55 | 33 | All SZGR 2.0 genes in this pathway |
CONCANNON APOPTOSIS BY EPOXOMICIN UP | 239 | 157 | All SZGR 2.0 genes in this pathway |
LANDIS ERBB2 BREAST TUMORS 324 DN | 149 | 93 | All SZGR 2.0 genes in this pathway |
WANG BARRETTS ESOPHAGUS AND ESOPHAGUS CANCER DN | 37 | 22 | All SZGR 2.0 genes in this pathway |
WANG ESOPHAGUS CANCER VS NORMAL DN | 101 | 66 | All SZGR 2.0 genes in this pathway |
HUMMERICH SKIN CANCER PROGRESSION DN | 100 | 64 | All SZGR 2.0 genes in this pathway |
XU HGF TARGETS REPRESSED BY AKT1 DN | 95 | 58 | All SZGR 2.0 genes in this pathway |
WEINMANN ADAPTATION TO HYPOXIA UP | 29 | 24 | All SZGR 2.0 genes in this pathway |
DAIRKEE TERT TARGETS DN | 124 | 79 | All SZGR 2.0 genes in this pathway |
GRUETZMANN PANCREATIC CANCER DN | 203 | 134 | All SZGR 2.0 genes in this pathway |
ONDER CDH1 TARGETS 1 UP | 140 | 85 | All SZGR 2.0 genes in this pathway |
HOUSTIS ROS | 36 | 29 | All SZGR 2.0 genes in this pathway |
TARTE PLASMA CELL VS PLASMABLAST UP | 398 | 262 | All SZGR 2.0 genes in this pathway |
FLECHNER BIOPSY KIDNEY TRANSPLANT REJECTED VS OK DN | 546 | 351 | All SZGR 2.0 genes in this pathway |
ABBUD LIF SIGNALING 1 UP | 46 | 29 | All SZGR 2.0 genes in this pathway |
KUMAR TARGETS OF MLL AF9 FUSION | 405 | 264 | All SZGR 2.0 genes in this pathway |
LEE AGING NEOCORTEX DN | 80 | 49 | All SZGR 2.0 genes in this pathway |
BROWNE HCMV INFECTION 16HR UP | 225 | 139 | All SZGR 2.0 genes in this pathway |
KAAB HEART ATRIUM VS VENTRICLE UP | 249 | 170 | All SZGR 2.0 genes in this pathway |
BROWNE HCMV INFECTION 8HR UP | 105 | 73 | All SZGR 2.0 genes in this pathway |
SIMBULAN PARP1 TARGETS UP | 31 | 23 | All SZGR 2.0 genes in this pathway |
BLALOCK ALZHEIMERS DISEASE UP | 1691 | 1088 | All SZGR 2.0 genes in this pathway |
KEEN RESPONSE TO ROSIGLITAZONE DN | 106 | 68 | All SZGR 2.0 genes in this pathway |
WANG CISPLATIN RESPONSE AND XPC UP | 202 | 115 | All SZGR 2.0 genes in this pathway |
HILLION HMGA1 TARGETS | 90 | 71 | All SZGR 2.0 genes in this pathway |
FUJII YBX1 TARGETS DN | 202 | 132 | All SZGR 2.0 genes in this pathway |
RIGGI EWING SARCOMA PROGENITOR UP | 430 | 288 | All SZGR 2.0 genes in this pathway |
BOQUEST STEM CELL CULTURED VS FRESH UP | 425 | 298 | All SZGR 2.0 genes in this pathway |
ICHIBA GRAFT VERSUS HOST DISEASE 35D UP | 131 | 79 | All SZGR 2.0 genes in this pathway |
VANASSE BCL2 TARGETS DN | 74 | 50 | All SZGR 2.0 genes in this pathway |
SWEET LUNG CANCER KRAS DN | 435 | 289 | All SZGR 2.0 genes in this pathway |
COLINA TARGETS OF 4EBP1 AND 4EBP2 | 356 | 214 | All SZGR 2.0 genes in this pathway |
MEISSNER NPC HCP WITH H3 UNMETHYLATED | 536 | 296 | All SZGR 2.0 genes in this pathway |
LIU VAV3 PROSTATE CARCINOGENESIS UP | 89 | 61 | All SZGR 2.0 genes in this pathway |
JISON SICKLE CELL DISEASE DN | 181 | 97 | All SZGR 2.0 genes in this pathway |
SAKAI CHRONIC HEPATITIS VS LIVER CANCER UP | 83 | 63 | All SZGR 2.0 genes in this pathway |
KOBAYASHI EGFR SIGNALING 24HR UP | 101 | 65 | All SZGR 2.0 genes in this pathway |
HOSHIDA LIVER CANCER SUBCLASS S3 | 266 | 180 | All SZGR 2.0 genes in this pathway |
NAKAYAMA SOFT TISSUE TUMORS PCA2 DN | 80 | 51 | All SZGR 2.0 genes in this pathway |
BROWNE HCMV INFECTION 30MIN UP | 56 | 38 | All SZGR 2.0 genes in this pathway |
MARTENS TRETINOIN RESPONSE UP | 857 | 456 | All SZGR 2.0 genes in this pathway |
BRUINS UVC RESPONSE EARLY LATE | 317 | 190 | All SZGR 2.0 genes in this pathway |
AZARE NEOPLASTIC TRANSFORMATION BY STAT3 UP | 121 | 70 | All SZGR 2.0 genes in this pathway |
KATSANOU ELAVL1 TARGETS UP | 169 | 105 | All SZGR 2.0 genes in this pathway |
PEDERSEN METASTASIS BY ERBB2 ISOFORM 7 | 403 | 240 | All SZGR 2.0 genes in this pathway |
PEDERSEN TARGETS OF 611CTF ISOFORM OF ERBB2 | 76 | 45 | All SZGR 2.0 genes in this pathway |
ACEVEDO FGFR1 TARGETS IN PROSTATE CANCER MODEL DN | 308 | 187 | All SZGR 2.0 genes in this pathway |
Section VI. microRNA annotation
miRNA family | Target position | miRNA ID | miRNA seq | ||
---|---|---|---|---|---|
UTR start | UTR end | Match method | |||
miR-24 | 703 | 709 | m8 | hsa-miR-24SZ | UGGCUCAGUUCAGCAGGAACAG |
miR-378 | 49 | 55 | 1A | hsa-miR-378 | CUCCUGACUCCAGGUCCUGUGU |
- SZ: miRNAs which differentially expressed in brain cortex of schizophrenia patients comparing with control samples using microarray. Clickhereto see the list of SZ related miRNAs.
- Brain: miRNAs which are expressed in brain based on miRNA microarray expression studies. Clickhereto see the list of brain related miRNAs.