Gene Page:GRIK2
Summary?
| GeneID | 2898 |
| Symbol | GRIK2 |
| Synonyms | EAA4|GLR6|GLUK6|GLUR6|GluK2|MRT6 |
| Description | glutamate ionotropic receptor kainate type subunit 2 |
| Reference | MIM:138244|HGNC:HGNC:4580|Ensembl:ENSG00000164418|HPRD:00692|Vega:OTTHUMG00000016328 |
| Gene type | protein-coding |
| Map location | 6q16.3 |
| Pascal p-value | 0.002 |
| Fetal beta | 1.717 |
| Support | LIGAND GATED ION SIGNALING G2Cdb.human_PocklingtonH1 G2Cdb.human_TAP-PSD-95-CORE G2Cdb.humanNRC G2Cdb.humanPSD G2Cdb.humanPSP Potential synaptic genes |
Gene in Data Sources
| Gene set name | Method of gene set | Description | Info |
|---|---|---|---|
| CV:GWASdb | Genome-wide Association Studies | GWASdb records for schizophrenia | |
| CV:PGCnp | Genome-wide Association Study | GWAS | |
| PMID:cooccur | High-throughput literature-search | Systematic search in PubMed for genes co-occurring with SCZ keywords. A total of 3027 genes were included. | |
| Association | A combined odds ratio method (Sun et al. 2008), association studies | 1 | Link to SZGene |
| Literature | High-throughput literature-search | Co-occurance with Schizophrenia keywords: schizophrenia,schizophrenic,schizophrenics,schizophrenias | Click to show details |
| GO_Annotation | Mapping neuro-related keywords to Gene Ontology annotations | Hits with neuro-related keywords: 7 | |
| Network | Shortest path distance of core genes in the Human protein-protein interaction network | Contribution to shortest path in PPI network: 15.5 |
Section I. Genetics and epigenetics annotation
Section II. Transcriptome annotation
General gene expression (GTEx)
Gene expression during devlopment (BrainCloud)
Footnote:
A total of 269 time points ploted, with n=38 fetal samples (x=1:38). Each triangle represents one time point.
Gene expression of temporal and spatial changes (BrainSpan)
Footnote:
SC: sub-cortical regions; SM: sensory-motor regions; FC: frontal cortex; and TP: temporal-parietal cortex
ST1: fetal (13 - 26 postconception weeks), ST2: early infancy to late childhood (4 months to 11 years), and ST3: adolescence to adulthood (13 - 23 years)
The bar shown representes the lower 25% and upper 25% of the expression distribution.
Top co-expressed genes in brain regions
| Top 10 positively co-expressed genes | ||
| Gene | Pearson's Correlation | Spearman's Correlation |
| MTMR9 | 0.88 | 0.93 |
| NRXN1 | 0.88 | 0.92 |
| CPEB4 | 0.88 | 0.92 |
| KIAA0317 | 0.88 | 0.93 |
| INPP4A | 0.88 | 0.92 |
| GABRB3 | 0.87 | 0.92 |
| ATRN | 0.87 | 0.92 |
| AVL9 | 0.87 | 0.92 |
| GNAQ | 0.87 | 0.91 |
| ATP9A | 0.87 | 0.92 |
| Top 10 negatively co-expressed genes | ||
| Gene | Pearson's Correlation | Spearman's Correlation |
| AF347015.31 | -0.65 | -0.74 |
| FXYD1 | -0.65 | -0.71 |
| MT-CO2 | -0.64 | -0.75 |
| HIGD1B | -0.63 | -0.74 |
| AC021016.1 | -0.63 | -0.71 |
| AF347015.33 | -0.63 | -0.69 |
| COPZ2 | -0.62 | -0.67 |
| AF347015.8 | -0.62 | -0.73 |
| MT-CYB | -0.62 | -0.70 |
| AF347015.27 | -0.62 | -0.70 |
Section III. Gene Ontology annotation
| Molecular function | 去的术语 | Evidence | Neuro keywords | PubMed ID |
|---|---|---|---|---|
| GO:0005234 | extracellular-glutamate-gated ion channel activity | IEA | glutamate (GO term level: 11) | - |
| GO:0015277 | kainate selective glutamate receptor activity | IDA | glutamate (GO term level: 8) | 15537878 |
| GO:0004872 | receptor activity | IEA | - | |
| GO:0005216 | ion channel activity | IEA | - | |
| Biological process | 去的术语 | Evidence | Neuro keywords | PubMed ID |
| GO:0048172 | regulation of short-term neuronal synaptic plasticity | IMP | neuron, Synap (GO term level: 10) | 15537878 |
| GO:0007215 | glutamate signaling pathway | TAS | glutamate (GO term level: 7) | 7536611 |
| GO:0050806 | positive regulation of synaptic transmission | IMP | 神经元,Synap(术语层面:9) | 15537878 |
| GO:0051402 | neuron apoptosis | IDA | neuron, axon, dendrite (GO term level: 7) | 15537878 |
| GO:0006811 | ion transport | IEA | - | |
| GO:0031557 | induction of programmed cell death in response to chemical stimulus | NAS | 15537878 | |
| Cellular component | 去的术语 | Evidence | Neuro keywords | PubMed ID |
| GO:0045211 | postsynaptic membrane | IEA | Synap, Neurotransmitter (GO term level: 5) | - |
| GO:0045202 | synapse | IEA | neuron, Synap, Neurotransmitter, Glial (GO term level: 2) | - |
| GO:0005886 | plasma membrane | IEA | - | |
| GO:0005887 | integral to plasma membrane | TAS | 7536611 | |
| GO:0030054 | cell junction | IEA | - |
Section IV. Protein-protein interaction annotation
| Interactors | Aliases B | Official full name B | Experimental | Source | PubMed ID |
|---|---|---|---|---|---|
| CASK | CAGH39 |发生| FLJ22219 | FLJ31914 | LIN2 | MICPCH | TNRC8 | calcium/calmodulin-dependent serine protein kinase (MAGUK family) | - | HPRD | 12151522 |
| CDH2 | CD325 | CDHN | CDw325 | NCAD | cadherin 2, type 1, N-cadherin (neuronal) | - | HPRD | 12151522 |
| CTNNB1 | CTNNB | DKFZp686D02253 | FLJ25606 | FLJ37923 | catenin (cadherin-associated protein), beta 1, 88kDa | - | HPRD | 12151522 |
| CTNND1 | CAS | CTNND | KIAA0384 | P120CAS | P120CTN | p120 | catenin (cadherin-associated protein), delta 1 | - | HPRD | 12151522 |
| DLG1 | DKFZp761P0818 | DKFZp781B0426 | DLGH1 | SAP97 | dJ1061C18.1.1 | hdlg | discs, large homolog 1 (Drosophila) | - | HPRD,BioGRID | 11279111 |
| DLG3 | KIAA1232 | MRX | MRX90 | NE-Dlg | NEDLG | SAP102 | discs, large homolog 3 (neuroendocrine-dlg, Drosophila) | - | HPRD | 12070168 |
| DLG3 | KIAA1232 | MRX | MRX90 | NE-Dlg | NEDLG | SAP102 | discs, large homolog 3 (neuroendocrine-dlg, Drosophila) | Affinity Capture-Western | BioGRID | 9808460 |
| DLG4 | FLJ97752 | FLJ98574 | PSD95 | SAP90 | discs, large homolog 4 (Drosophila) | - | HPRD | 9808460|11276111 |12597860 |
| DLG4 | FLJ97752 | FLJ98574 | PSD95 | SAP90 | discs, large homolog 4 (Drosophila) | Affinity Capture-Western Reconstituted Complex |
BioGRID | 9808460|11279111 |12597860 |
| GRIA1 | GLUH1 | GLUR1 | GLURA | HBGR1 | MGC133252 | glutamate receptor, ionotropic, AMPA 1 | Affinity Capture-Western | BioGRID | 8288598 |
| GRIA1 | GLUH1 | GLUR1 | GLURA | HBGR1 | MGC133252 | glutamate receptor, ionotropic, AMPA 1 | - | HPRD | 10358037 |
| GRIA2 | GLUR2 | GLURB | GluR-K2 | HBGR2 | glutamate receptor, ionotropic, AMPA 2 | Affinity Capture-Western | BioGRID | 8288598 |
| GRID2 | MGC117022 | MGC117023 | MGC117024 | glutamate receptor, ionotropic, delta 2 | Affinity Capture-Western | BioGRID | 12573530 |
| GRID2 | MGC117022 | MGC117023 | MGC117024 | glutamate receptor, ionotropic, delta 2 | GluR6 interacts with GluR-delta-2 | BIND | 12573530 |
| GRIK4 | EAA1 | GRIK | KA1 | glutamate receptor, ionotropic, kainate 4 | - | HPRD | 8288598|12954862 |
| GRIK5 | EAA2 | GRIK2 | KA2 | glutamate receptor, ionotropic, kainate 5 | - | HPRD,BioGRID | 9466455 |
| GRIP1 | GRIP | glutamate receptor interacting protein 1 | Reconstituted Complex | BioGRID | 11891216|12597860 |
| PICK1 | MGC15204 | PICK | PRKCABP | protein interacting with PRKCA 1 | - | HPRD,BioGRID | 12597860 |
| SDCBP | MDA-9 | ST1 | SYCL | TACIP18 | syndecan binding protein (syntenin) | - | HPRD,BioGRID | 12597860 |
Section V. Pathway annotation
| Pathway name | Pathway size | # SZGR 2.0 genes in pathway | Info |
|---|---|---|---|
| KEGG NEUROACTIVE LIGAND RECEPTOR INTERACTION | 272 | 195 | All SZGR 2.0 genes in this pathway |
| REACTOME TRANSMISSION ACROSS CHEMICAL SYNAPSES | 186 | 155 | All SZGR 2.0 genes in this pathway |
| REACTOME NEURONAL SYSTEM | 279 | 221 | All SZGR 2.0 genes in this pathway |
| REACTOME NEUROTRANSMITTER RECEPTOR BINDING AND DOWNSTREAM TRANSMISSION IN THE POSTSYNAPTIC CELL | 137 | 110 | All SZGR 2.0 genes in this pathway |
| REACTOME ACTIVATION OF KAINATE RECEPTORS UPON GLUTAMATE BINDING | 31 | 23 | All SZGR 2.0 genes in this pathway |
| REACTOME IONOTROPIC ACTIVITY OF KAINATE RECEPTORS | 11 | 11 | All SZGR 2.0 genes in this pathway |
| ODONNELL TFRC TARGETS UP | 456 | 228 | All SZGR 2.0 genes in this pathway |
| ZHOU INFLAMMATORY RESPONSE FIMA UP | 544 | 308 | All SZGR 2.0 genes in this pathway |
| KINSEY TARGETS OF EWSR1 FLII FUSION UP | 1278 | 748 | All SZGR 2.0 genes in this pathway |
| BROWNE HCMV INFECTION 24HR DN | 148 | 102 | All SZGR 2.0 genes in this pathway |
| ULE SPLICING VIA NOVA2 | 43 | 38 | All SZGR 2.0 genes in this pathway |
| BAELDE DIABETIC NEPHROPATHY DN | 434 | 302 | All SZGR 2.0 genes in this pathway |
| RIGGI EWING SARCOMA PROGENITOR UP | 430 | 288 | All SZGR 2.0 genes in this pathway |
| ACEVEDO LIVER CANCER WITH H3K27ME3 DN | 228 | 114 | All SZGR 2.0 genes in this pathway |
| ACEVEDO METHYLATED IN LIVER CANCER DN | 940 | 425 | All SZGR 2.0 genes in this pathway |
| LABBE TGFB1 TARGETS UP | 102 | 64 | All SZGR 2.0 genes in this pathway |
| NUTT GBM VS AO GLIOMA DN | 45 | 22 | All SZGR 2.0 genes in this pathway |
| YAGI AML WITH 11Q23 REARRANGED | 351 | 238 | All SZGR 2.0 genes in this pathway |
| MEISSNER NPC HCP WITH H3K4ME2 | 491 | 319 | All SZGR 2.0 genes in this pathway |
| BROWNE HCMV INFECTION 4HR UP | 55 | 41 | All SZGR 2.0 genes in this pathway |
| HOELZEL NF1 TARGETS UP | 139 | 93 | All SZGR 2.0 genes in this pathway |
| BRUINS UVC RESPONSE EARLY LATE | 317 | 190 | All SZGR 2.0 genes in this pathway |
| ZWANG TRANSIENTLY UP BY 2ND EGF PULSE ONLY | 1725 | 838 | All SZGR 2.0 genes in this pathway |
Section VI. microRNA annotation
| miRNA family | Target position | miRNA ID | miRNA seq | ||
|---|---|---|---|---|---|
| UTR start | UTR end | Match method | |||
| let-7/98 | 105 | 111 | 1A | hsa-let-7abrain | UGAGGUAGUAGGUUGUAUAGUU |
| hsa-let-7bbrain | UGAGGUAGUAGGUUGUGUGGUU | ||||
| hsa-let-7cbrain | UGAGGUAGUAGGUUGUAUGGUU | ||||
| hsa-let-7dbrain | AGAGGUAGUAGGUUGCAUAGU | ||||
| hsa-let-7ebrain | UGAGGUAGGAGGUUGUAUAGU | ||||
| hsa-let-7fbrain | UGAGGUAGUAGAUUGUAUAGUU | ||||
| hsa-miR-98brain | UGAGGUAGUAAGUUGUAUUGUU | ||||
| hsa-let-7gSZ | UGAGGUAGUAGUUUGUACAGU | ||||
| hsa-let-7ibrain | UGAGGUAGUAGUUUGUGCUGU | ||||
| miR-153 | 77 | 83 | 1A | hsa-miR-153 | UUGCAUAGUCACAAAAGUGA |
| miR-181 | 246 | 252 | m8 | hsa-miR-181abrain | AACAUUCAACGCUGUCGGUGAGU |
| hsa-miR-181bSZ | AACAUUCAUUGCUGUCGGUGGG | ||||
| hsa-miR-181cbrain | AACAUUCAACCUGUCGGUGAGU | ||||
| hsa-miR-181dbrain | AACAUUCAUUGUUGUCGGUGGGUU | ||||
| miR-217 | 282 | 288 | m8 | hsa-miR-217 | UACUGCAUCAGGAACUGAUUGGAU |
| miR-218 | 21 | 28 | 1A,m8 | hsa-miR-218brain | UUGUGCUUGAUCUAACCAUGU |
| miR-363 | 87 | 93 | 1A | hsa-miR-363 | AUUGCACGGUAUCCAUCUGUAA |
| miR-376 | 122 | 129 | 1A,m8 | hsa-miR-376a | AUCAUAGAGGAAAAUCCACGU |
| hsa-miR-376b | AUCAUAGAGGAAAAUCCAUGUU | ||||
| miR-448 | 76 | 83 | 1A,m8 | hsa-miR-448 | UUGCAUAUGUAGGAUGUCCCAU |
| miR-494 | 61 | 67 | m8 | hsa-miR-494brain | UGAAACAUACACGGGAAACCUCUU |
| miR-543 | 59 | 65 | m8 | hsa-miR-543 | AAACAUUCGCGGUGCACUUCU |
| hsa-miR-543 | AAACAUUCGCGGUGCACUUCU | ||||
- SZ: miRNAs which differentially expressed in brain cortex of schizophrenia patients comparing with control samples using microarray. Clickhereto see the list of SZ related miRNAs.
- Brain: miRNAs which are expressed in brain based on miRNA microarray expression studies. Clickhereto see the list of brain related miRNAs.