Gene Page:GUCY1A2

Summary?
GeneID 2977
Symbol GUCY1A2
Synonyms GC-SA2|GUC1A2
Description guanylate cyclase 1, soluble, alpha 2
Reference MIM:601244|HGNC:HGNC:4684|Ensembl:ENSG00000152402|HPRD:03146|Vega:OTTHUMG00000166296
Gene type protein-coding
Map location 11q21-q22
Pascal p-value 0.284
Fetal beta 0.618
eGene Myers' cis & trans
支持 INTRACELLULAR SIGNAL TRANSDUCTION
G2Cdb.humanPSD
G2Cdb.humanPSP

Gene in Data Sources
Gene set name Method of gene set Description Info
CV:GWASdb Genome-wide Association Studies GWASdb records for schizophrenia
CV:PGCnp Genome-wide Association Study GWAS
GSMA_I Genome scan meta-analysis Psr: 0.006

Section I. Genetics and epigenetics annotation

@eQTL annotation

SNP ID Chromosome Position eGene Gene Entrez ID pvalue qvalue TSS distance eQTL type
rs12447283 chr16 65595638 GUCY1A2 2977 0.14 trans

Section II. Transcriptome annotation

General gene expression (GTEx)

Not available

Gene expression during devlopment (BrainCloud)

Footnote:
A total of 269 time points ploted, with n=38 fetal samples (x=1:38). Each triangle represents one time point.

Gene expression of temporal and spatial changes (BrainSpan)

Footnote:
SC: sub-cortical regions; SM: sensory-motor regions; FC: frontal cortex; and TP: temporal-parietal cortex
ST1: fetal (13 - 26 postconception weeks), ST2: early infancy to late childhood (4 months to 11 years), and ST3: adolescence to adulthood (13 - 23 years)
The bar shown representes the lower 25% and upper 25% of the expression distribution.

No co-expressed genes in brain regions


Section III. Gene Ontology annotation

Molecular function GO term Evidence Neuro keywords PubMed ID
GO:0004383 guanylate cyclase activity TAS 1683630
GO:0020037 heme binding IEA -
Biological process GO term Evidence Neuro keywords PubMed ID
GO:0007242 intracellular signaling cascade IEA -
GO:0006182 cGMP biosynthetic process IEA -
Cellular component GO term Evidence Neuro keywords PubMed ID
GO:0005737 cytoplasm IEA -

Section V. Pathway annotation

Pathway name Pathway size # SZGR 2.0 genes in pathway Info
KEGG PURINE METABOLISM 159 96 All SZGR 2.0 genes in this pathway
KEGG VASCULAR SMOOTH MUSCLE CONTRACTION 115 81 All SZGR 2.0 genes in this pathway
KEGG缝隙连接 90 68 All SZGR 2.0 genes in this pathway
KEGG LONG TERM DEPRESSION 70 53 All SZGR 2.0 genes in this pathway
REACTOME NITRIC OXIDE STIMULATES GUANYLATE CYCLASE 25 19 All SZGR 2.0 genes in this pathway
REACTOME PLATELET HOMEOSTASIS 78 49 All SZGR 2.0 genes in this pathway
REACTOME HEMOSTASIS 466 331 All SZGR 2.0 genes in this pathway
SENESE HDAC3 TARGETS UP 501 327 All SZGR 2.0 genes in this pathway
BENPORATH SUZ12 TARGETS 1038 678 All SZGR 2.0 genes in this pathway
KAYO AGING MUSCLE UP 244 165 All SZGR 2.0 genes in this pathway
BROWNE HCMV INFECTION 18HR DN 178 121 All SZGR 2.0 genes in this pathway
CROONQUIST STROMAL STIMULATION UP 60 42 All SZGR 2.0 genes in this pathway
YAGI AML WITH T 8 21 TRANSLOCATION 368 247 All SZGR 2.0 genes in this pathway
DUTERTRE ESTRADIOL RESPONSE 24HR DN 505 328 All SZGR 2.0 genes in this pathway
ZWANG TRANSIENTLY UP BY 1ST EGF PULSE ONLY 1839 928 All SZGR 2.0 genes in this pathway

Section VI. microRNA annotation

miRNA family Target position miRNA ID miRNA seq
UTR start UTR end Match method
miR-218 31 38 1A,m8 hsa-miR-218brain UUGUGCUUGAUCUAACCAUGU