Gene Page:GUCY1A2
Summary?
GeneID | 2977 |
Symbol | GUCY1A2 |
Synonyms | GC-SA2|GUC1A2 |
Description | guanylate cyclase 1, soluble, alpha 2 |
Reference | MIM:601244|HGNC:HGNC:4684|Ensembl:ENSG00000152402|HPRD:03146|Vega:OTTHUMG00000166296 |
Gene type | protein-coding |
Map location | 11q21-q22 |
Pascal p-value | 0.284 |
Fetal beta | 0.618 |
eGene | Myers' cis & trans |
支持 | INTRACELLULAR SIGNAL TRANSDUCTION G2Cdb.humanPSD G2Cdb.humanPSP |
Gene in Data Sources
Gene set name | Method of gene set | Description | Info |
---|---|---|---|
CV:GWASdb | Genome-wide Association Studies | GWASdb records for schizophrenia | |
CV:PGCnp | Genome-wide Association Study | GWAS | |
GSMA_I | Genome scan meta-analysis | Psr: 0.006 |
Section I. Genetics and epigenetics annotation
eQTL annotation
SNP ID | Chromosome | Position | eGene | Gene Entrez ID | pvalue | qvalue | TSS distance | eQTL type |
---|---|---|---|---|---|---|---|---|
rs12447283 | chr16 | 65595638 | GUCY1A2 | 2977 | 0.14 | trans |
Section II. Transcriptome annotation
General gene expression (GTEx)
![Not available](http://www.tjghsg.com/bioinfo/SZGR/GeneImg/GUCY1A2_DE_GTEx.png)
Gene expression during devlopment (BrainCloud)
Footnote:
A total of 269 time points ploted, with n=38 fetal samples (x=1:38). Each triangle represents one time point.
Gene expression of temporal and spatial changes (BrainSpan)
Footnote:
SC: sub-cortical regions; SM: sensory-motor regions; FC: frontal cortex; and TP: temporal-parietal cortex
ST1: fetal (13 - 26 postconception weeks), ST2: early infancy to late childhood (4 months to 11 years), and ST3: adolescence to adulthood (13 - 23 years)
The bar shown representes the lower 25% and upper 25% of the expression distribution.
No co-expressed genes in brain regions
Section III. Gene Ontology annotation
Molecular function | GO term | Evidence | Neuro keywords | PubMed ID |
---|---|---|---|---|
GO:0004383 | guanylate cyclase activity | TAS | 1683630 | |
GO:0020037 | heme binding | IEA | - | |
Biological process | GO term | Evidence | Neuro keywords | PubMed ID |
GO:0007242 | intracellular signaling cascade | IEA | - | |
GO:0006182 | cGMP biosynthetic process | IEA | - | |
Cellular component | GO term | Evidence | Neuro keywords | PubMed ID |
GO:0005737 | cytoplasm | IEA | - |
Section V. Pathway annotation
Pathway name | Pathway size | # SZGR 2.0 genes in pathway | Info |
---|---|---|---|
KEGG PURINE METABOLISM | 159 | 96 | All SZGR 2.0 genes in this pathway |
KEGG VASCULAR SMOOTH MUSCLE CONTRACTION | 115 | 81 | All SZGR 2.0 genes in this pathway |
KEGG缝隙连接 | 90 | 68 | All SZGR 2.0 genes in this pathway |
KEGG LONG TERM DEPRESSION | 70 | 53 | All SZGR 2.0 genes in this pathway |
REACTOME NITRIC OXIDE STIMULATES GUANYLATE CYCLASE | 25 | 19 | All SZGR 2.0 genes in this pathway |
REACTOME PLATELET HOMEOSTASIS | 78 | 49 | All SZGR 2.0 genes in this pathway |
REACTOME HEMOSTASIS | 466 | 331 | All SZGR 2.0 genes in this pathway |
SENESE HDAC3 TARGETS UP | 501 | 327 | All SZGR 2.0 genes in this pathway |
BENPORATH SUZ12 TARGETS | 1038 | 678 | All SZGR 2.0 genes in this pathway |
KAYO AGING MUSCLE UP | 244 | 165 | All SZGR 2.0 genes in this pathway |
BROWNE HCMV INFECTION 18HR DN | 178 | 121 | All SZGR 2.0 genes in this pathway |
CROONQUIST STROMAL STIMULATION UP | 60 | 42 | All SZGR 2.0 genes in this pathway |
YAGI AML WITH T 8 21 TRANSLOCATION | 368 | 247 | All SZGR 2.0 genes in this pathway |
DUTERTRE ESTRADIOL RESPONSE 24HR DN | 505 | 328 | All SZGR 2.0 genes in this pathway |
ZWANG TRANSIENTLY UP BY 1ST EGF PULSE ONLY | 1839 | 928 | All SZGR 2.0 genes in this pathway |
Section VI. microRNA annotation
miRNA family | Target position | miRNA ID | miRNA seq | ||
---|---|---|---|---|---|
UTR start | UTR end | Match method | |||
miR-218 | 31 | 38 | 1A,m8 | hsa-miR-218brain | UUGUGCUUGAUCUAACCAUGU |
- SZ: miRNAs which differentially expressed in brain cortex of schizophrenia patients comparing with control samples using microarray. Clickhereto see the list of SZ related miRNAs.
- Brain: miRNAs which are expressed in brain based on miRNA microarray expression studies. Clickhereto see the list of brain related miRNAs.