Gene Page:TFCP2L1
Summary?
GeneID | 29842 |
Symbol | TFCP2L1 |
Synonyms | CRTR1|LBP-9|LBP9 |
Description | transcription factor CP2-like 1 |
Reference | MIM:609785|HGNC:HGNC:17925|Ensembl:ENSG00000115112|HPRD:18175|Vega:OTTHUMG00000131443 |
Gene type | protein-coding |
Map location | 2q14 |
Pascal p-value | 0.451 |
TADA p-value | 0.012 |
Gene in Data Sources
Gene set name | Method of gene set | Description | Info |
---|---|---|---|
CV:PGCnp | Genome-wide Association Study | GWAS | |
DNM:McCarthy_2014 | Whole Exome Sequencing analysis | Whole exome sequencing of 57 trios with sporadic or familial schizophrenia. | |
GSMA_I | Genome scan meta-analysis | Psr: 0.023 | |
GSMA_IIA | Genome scan meta-analysis (All samples) | Psr: 0.00755 | |
Expression | Meta-analysis of gene expression | Pvalue: 1.59 |
Section I. Genetics and epigenetics annotation
DNM table
Gene | Chromosome | Position | Ref | Alt | Transcript | AA change | Mutation type | Sift | CG46 | Trait | Study |
---|---|---|---|---|---|---|---|---|---|---|---|
TFCP2L1 | chr2 | 122000033 | G | T | NM_014553 | p.D224Y | missense SNV | C | D | Schizophrenia | DNM:McCarthy_2014 |
Section II. Transcriptome annotation
General gene expression (GTEx)
![Not available](http://www.tjghsg.com/bioinfo/SZGR/GeneImg/TFCP2L1_DE_GTEx.png)
Gene expression of temporal and spatial changes (BrainSpan)
Footnote:
SC: sub-cortical regions; SM: sensory-motor regions; FC: frontal cortex; and TP: temporal-parietal cortex
ST1: fetal (13 - 26 postconception weeks), ST2: early infancy to late childhood (4 months to 11 years), and ST3: adolescence to adulthood (13 - 23 years)
The bar shown representes the lower 25% and upper 25% of the expression distribution.
Top co-expressed genes in brain regions
Top 10 positively co-expressed genes | ||
Gene | Pearson's Correlation | Spearman's Correlation |
C14orf93 | 0.91 | 0.88 |
TRIM28 | 0.91 | 0.74 |
EIF4EBP1 | 0.91 | 0.74 |
MTA2 | 0.90 | 0.79 |
FOXG1B | 0.90 | 0.71 |
DDAH2 | 0.90 | 0.81 |
ZNF250 | 0.89 | 0.73 |
RNF122 | 0.89 | 0.78 |
H3F3B | 0.89 | 0.82 |
IGFBP2 | 0.89 | 0.66 |
Top 10 negatively co-expressed genes | ||
Gene | Pearson's Correlation | Spearman's Correlation |
C5orf53 | -0.61 | -0.66 |
PLA2G4A | -0.58 | -0.69 |
ME1 | -0.58 | -0.60 |
FBXO2 | -0.58 | -0.60 |
AF347015.31 | -0.58 | -0.70 |
CCNI2 | -0.58 | -0.63 |
AF347015.27 | -0.57 | -0.70 |
ABCG2 | -0.57 | -0.61 |
PTH1R | -0.57 | -0.58 |
HLA-F | -0.56 | -0.57 |
Section III. Gene Ontology annotation
Molecular function | 去的术语 | Evidence | Neuro keywords | PubMed ID |
---|---|---|---|---|
GO:0003700 | transcription factor activity | TAS | 10644752 | |
GO:0003714 | transcription corepressor activity | TAS | 10644752 | |
GO:0016565 | general transcriptional repressor activity | IEA | - | |
Biological process | 去的术语 | Evidence | Neuro keywords | PubMed ID |
GO:0000122 | negative regulation of transcription from RNA polymerase II promoter | IEA | - | |
GO:0000902 | cell morphogenesis | IEA | - | |
GO:0002070 | epithelial cell maturation | IEA | - | |
GO:0006350 | transcription | IEA | - | |
去:0008340 | determination of adult life span | IEA | - | |
GO:0007431 | salivary gland development | IEA | - | |
GO:0007565 | female pregnancy | TAS | 10644752 | |
GO:0007028 | cytoplasm organization | IEA | - | |
GO:0006694 | steroid biosynthetic process | TAS | 10644752 | |
GO:0045927 | positive regulation of growth | IEA | - | |
Cellular component | 去的术语 | Evidence | Neuro keywords | PubMed ID |
GO:0005634 | nucleus | IEA | - | |
GO:0005737 | cytoplasm | IEA | - | |
GO:0016020 | membrane | IEA | - |
Section V. Pathway annotation
Pathway name | Pathway size | # SZGR 2.0 genes in pathway | Info |
---|---|---|---|
LIU PROSTATE CANCER DN | 481 | 290 | All SZGR 2.0 genes in this pathway |
SENGUPTA NASOPHARYNGEAL CARCINOMA WITH LMP1 DN | 175 | 82 | All SZGR 2.0 genes in this pathway |
GRAESSMANN APOPTOSIS BY DOXORUBICIN UP | 1142 | 669 | All SZGR 2.0 genes in this pathway |
GRAESSMANN RESPONSE TO MC AND DOXORUBICIN UP | 612 | 367 | All SZGR 2.0 genes in this pathway |
MCBRYAN PUBERTAL BREAST 3 4WK UP | 214 | 144 | All SZGR 2.0 genes in this pathway |
RIZ ERYTHROID DIFFERENTIATION APOBEC2 | 27 | 19 | All SZGR 2.0 genes in this pathway |
RIZ ERYTHROID DIFFERENTIATION 12HR | 43 | 35 | All SZGR 2.0 genes in this pathway |
LIANG HEMATOPOIESIS STEM CELL NUMBER SMALL VS HUGE UP | 38 | 29 | All SZGR 2.0 genes in this pathway |
SCHAEFFER PROSTATE DEVELOPMENT 48HR UP | 487 | 286 | All SZGR 2.0 genes in this pathway |
BENPORATH ES CORE NINE CORRELATED | 100 | 68 | All SZGR 2.0 genes in this pathway |
GEORGES TARGETS OF MIR192 AND MIR215 | 893 | 528 | All SZGR 2.0 genes in this pathway |
ONDER CDH1 TARGETS 2 DN | 464 | 276 | All SZGR 2.0 genes in this pathway |
LANDEMAINE LUNG METASTASIS | 21 | 12 | All SZGR 2.0 genes in this pathway |
BYSTRYKH HEMATOPOIESIS STEM CELL QTL TRANS | 882 | 572 | All SZGR 2.0 genes in this pathway |
由喀斯特IWANAGA致癌作用PTEN UP | 181 | 112 | All SZGR 2.0 genes in this pathway |
由喀斯特IWANAGA致癌作用UP | 170 | 107 | All SZGR 2.0 genes in this pathway |
AMBROSINI FLAVOPIRIDOL TREATMENT TP53 | 109 | 63 | All SZGR 2.0 genes in this pathway |
SMID BREAST CANCER RELAPSE IN BONE DN | 315 | 197 | All SZGR 2.0 genes in this pathway |
SMID BREAST CANCER BASAL UP | 648 | 398 | All SZGR 2.0 genes in this pathway |
SWEET LUNG CANCER KRAS UP | 491 | 316 | All SZGR 2.0 genes in this pathway |
MEISSNER NPC HCP WITH H3 UNMETHYLATED | 536 | 296 | All SZGR 2.0 genes in this pathway |
MEISSNER BRAIN HCP WITH H3K4ME3 AND H3K27ME3 | 1069 | 729 | All SZGR 2.0 genes in this pathway |
ROME INSULIN TARGETS IN MUSCLE DN | 204 | 114 | All SZGR 2.0 genes in this pathway |
KORKOLA CORRELATED WITH POU5F1 | 34 | 12 | All SZGR 2.0 genes in this pathway |
YAO TEMPORAL RESPONSE TO PROGESTERONE CLUSTER 1 | 68 | 50 | All SZGR 2.0 genes in this pathway |
FIGUEROA AML METHYLATION CLUSTER 1 DN | 48 | 30 | All SZGR 2.0 genes in this pathway |
BRUINS UVC RESPONSE LATE | 1137 | 655 | All SZGR 2.0 genes in this pathway |
PASINI SUZ12 TARGETS UP | 112 | 65 | All SZGR 2.0 genes in this pathway |
LEE BMP2 TARGETS UP | 745 | 475 | All SZGR 2.0 genes in this pathway |
RAO BOUND BY SALL4 | 227 | 149 | All SZGR 2.0 genes in this pathway |
LIM MAMMARY STEM CELL DN | 428 | 246 | All SZGR 2.0 genes in this pathway |
ZWANG TRANSIENTLY UP BY 1ST EGF PULSE ONLY | 1839 | 928 | All SZGR 2.0 genes in this pathway |
ZWANG EGF INTERVAL DN | 214 | 124 | All SZGR 2.0 genes in this pathway |
Section VI. microRNA annotation
miRNA family | Target position | miRNA ID | miRNA seq | ||
---|---|---|---|---|---|
UTR start | UTR end | Match method | |||
miR-124/506 | 587 | 593 | m8 | hsa-miR-506 | UAAGGCACCCUUCUGAGUAGA |
hsa-miR-124brain | UAAGGCACGCGGUGAAUGCC |
- SZ: miRNAs which differentially expressed in brain cortex of schizophrenia patients comparing with control samples using microarray. Clickhereto see the list of SZ related miRNAs.
- Brain: miRNAs which are expressed in brain based on miRNA microarray expression studies. Clickhereto see the list of brain related miRNAs.