Gene Page:EPN1

Summary?
GeneID 29924
Symbol EPN1
Synonyms -
Description epsin 1
Reference MIM:607262|HGNC:HGNC:21604|Ensembl:ENSG00000063245|HPRD:06270|Vega:OTTHUMG00000180911
Gene type protein-coding
Map location 19q13.42
Pascal p-value 0.058
Sherlock p-value 0.233
Fetal beta -0.313
DMG 1 (# studies)
Support CompositeSet
Darnell FMRP targets

Gene in Data Sources
Gene set name Method of gene set Description Info
CV:PGCnp Genome-wide Association Study GWAS
DMG:vanEijk_2014 Genome-wide DNA methylation analysis This dataset includes 432 differentially methylated CpG sites corresponding to 391 unique transcripts between schizophrenia patients (n=260) and unaffected controls (n=250). 1
Network Shortest path distance of core genes in the Human protein-protein interaction network Contribution to shortest path in PPI network: 0.0058

Section I. Genetics and epigenetics annotation

@Differentially methylated gene

Probe Chromosome Position Nearest gene P (dis) Beta (dis) FDR (dis) Study
cg17387916 19 55896965 EPN1 3.549E-4 3.328 DMG:vanEijk_2014


Section II. Transcriptome annotation

General gene expression (GTEx)

Not available

Gene expression during devlopment (BrainCloud)

Footnote:
A total of 269 time points ploted, with n=38 fetal samples (x=1:38). Each triangle represents one time point.

Gene expression of temporal and spatial changes (BrainSpan)

Footnote:
SC: sub-cortical regions; SM: sensory-motor regions; FC: frontal cortex; and TP: temporal-parietal cortex
ST1: fetal (13 - 26 postconception weeks), ST2: early infancy to late childhood (4 months to 11 years), and ST3: adolescence to adulthood (13 - 23 years)
The bar shown representes the lower 25% and upper 25% of the expression distribution.

No co-expressed genes in brain regions


Section III. Gene Ontology annotation

Molecular function GO term Evidence Neuro keywords PubMed ID
GO:0008289 lipid binding IEA -
Biological process GO term Evidence Neuro keywords PubMed ID
GO:0006897 endocytosis TAS 9723620
Cellular component GO term Evidence Neuro keywords PubMed ID
GO:0005634 nucleus IEA -
GO:0005737 cytoplasm IEA -
GO:0005905 coated pit IEA -
GO:0005886 plasma membrane EXP 10567358|12218189|15962011
GO:0005886 plasma membrane IEA -

Section IV. Protein-protein interaction annotation

Interactors Aliases B Official full name B Experimental Source PubMed ID
AP2A1 ADTAA | AP2-ALPHA | CLAPA1 adaptor-related蛋白质complex 2, alpha 1 subunit - HPRD 9723620
AP2A2 ADTAB | CLAPA2 | HIP9 | HYPJ adaptor-related蛋白质complex 2, alpha 2 subunit Affinity Capture-Western
Reconstituted Complex		 BioGRID 9723620
CLTC CHC | CHC17 | CLH-17 | CLTCL2 | Hc | KIAA0034 clathrin, heavy chain (Hc) - HPRD,BioGRID 10692452
CRMP1 DPYSL1 | DRP-1 | DRP1 collapsin response mediator protein 1 Two-hybrid BioGRID 16169070
EPS15 AF-1P | AF1P | MLLT5 epidermal growth factor receptor pathway substrate 15 - HPRD,BioGRID 9723620
EPS15L1 EPS15R epidermal growth factor receptor pathway substrate 15-like 1 Affinity Capture-Western BioGRID 9723620
GTF3A AP2 | TFIIIA general transcription factor IIIA Affinity Capture-Western BioGRID 12775724
KIAA1377 - KIAA1377 Two-hybrid BioGRID 16169070
MED31 3110004H13Rik | CGI-125 | FLJ27436 | FLJ36714 | Soh1 mediator complex subunit 31 Two-hybrid BioGRID 16169070
RALBP1 RIP1 | RLIP1 | RLIP76 ralA binding protein 1 Affinity Capture-Western BioGRID 12775724
REPS2 POB1 RALBP1 associated Eps domain containing 2 - HPRD,BioGRID 10557078
ZBTB16 PLZF | ZNF145 zinc finger and BTB domain containing 16 - HPRD 10791968


Section V. Pathway annotation

Pathway name Pathway size # SZGR 2.0 genes in pathway Info
KEGG ENDOCYTOSIS 183 132 All SZGR 2.0 genes in this pathway
BIOCARTA NDKDYNAMIN PATHWAY 21 15 All SZGR 2.0 genes in this pathway
PID ERBB1 INTERNALIZATION PATHWAY 41 35 All SZGR 2.0 genes in this pathway
REACTOME SIGNALING BY EGFR IN CANCER 109 80 All SZGR 2.0 genes in this pathway
REACTOME EGFR DOWNREGULATION 25 14 All SZGR 2.0 genes in this pathway
THUM SYSTOLIC HEART FAILURE DN 244 147 All SZGR 2.0 genes in this pathway
GINESTIER BREAST CANCER ZNF217 AMPLIFIED DN 335 193 All SZGR 2.0 genes in this pathway
BONOME OVARIAN CANCER SURVIVAL SUBOPTIMAL DEBULKING 510 309 All SZGR 2.0 genes in this pathway
YOSHIMURA MAPK8 TARGETS UP 1305 895 All SZGR 2.0 genes in this pathway
AGUIRRE PANCREATIC CANCER COPY NUMBER UP 298 174 All SZGR 2.0 genes in this pathway

Section VI. microRNA annotation

miRNA family Target position miRNA ID miRNA seq
UTR start UTR end Match method
miR-23 75 81 1A hsa-miR-23abrain AUCACAUUGCCAGGGAUUUCC
hsa-miR-23bbrain AUCACAUUGCCAGGGAUUACC