Gene Page:HABP2

Summary?
GeneID 3026
Symbol HABP2
Synonyms FSAP|HABP|HGFAL|NMTC5|PHBP
Description hyaluronan binding protein 2
Reference MIM:603924|HGNC:HGNC:4798|Ensembl:ENSG00000148702|HPRD:04890|Vega:OTTHUMG00000019073
Gene type protein-coding
Map location 10q25.3
Pascal p-value 0.006

Gene in Data Sources
Gene set name Method of gene set Description Info
CV:PGCnp Genome-wide Association Study GWAS
PMID:cooccur High-throughput literature-search 系统搜索PubMed的genes co-occurring with SCZ keywords. A total of 3027 genes were included.
Literature High-throughput literature-search Co-occurance with Schizophrenia keywords: schizophrenia,schizophrenias Click to show details
GO_Annotation Mapping neuro-related keywords to Gene Ontology annotations Hits with neuro-related keywords: 1

Section I. Genetics and epigenetics annotation


Section II. Transcriptome annotation

General gene expression (GTEx)

Not available

Gene expression of temporal and spatial changes (BrainSpan)

Footnote:
SC: sub-cortical regions; SM: sensory-motor regions; FC: frontal cortex; and TP: temporal-parietal cortex
ST1: fetal (13 - 26 postconception weeks), ST2: early infancy to late childhood (4 months to 11 years), and ST3: adolescence to adulthood (13 - 23 years)
The bar shown representes the lower 25% and upper 25% of the expression distribution.

Top co-expressed genes in brain regions

Top 10 positively co-expressed genes
Gene Pearson's Correlation Spearman's Correlation
HBD 0.99 0.99
SCRG1 0.71 0.49
LGALS3 0.69 0.51
FTL 0.68 0.64
RTP4 0.67 0.50
MT3 0.66 0.52
CGRRF1 0.66 0.43
C1orf61 0.66 0.55
PXMP3 0.66 0.48
PSMB8 0.65 0.57
Top 10 negatively co-expressed genes
Gene Pearson's Correlation Spearman's Correlation
HNRNPUL2 -0.57 -0.59
MYO18A -0.54 -0.54
TRAF3IP1 -0.54 -0.61
GOLGA2 -0.54 -0.47
GRIPAP1 -0.54 -0.52
MPHOSPH8 -0.53 -0.61
NOM1 -0.53 -0.59
AEBP2 -0.53 -0.54
ANKRD11 -0.52 -0.55
SURF6 -0.52 -0.52

Section III. Gene Ontology annotation

Molecular function 去的术语 Evidence Neuro keywords PubMed ID
GO:0004252 serine-type endopeptidase activity IEA glutamate (GO term level: 7) -
GO:0005539 glycosaminoglycan binding TAS 8827452
GO:0008233 peptidase activity IEA -
Biological process 去的术语 Evidence Neuro keywords PubMed ID
GO:0007155 cell adhesion TAS 8827452
GO:0006508 proteolysis IEA -
Cellular component 去的术语 Evidence Neuro keywords PubMed ID
GO:0005576 extracellular region NAS 14718574
GO:0005615 extracellular space TAS 8827452

Section V. Pathway annotation

Pathway name Pathway size # SZGR 2.0 genes in pathway Info
OSAWA TNF TARGETS 10 6 All SZGR 2.0 genes in this pathway
MATSUDA NATURAL KILLER DIFFERENTIATION 475 313 All SZGR 2.0 genes in this pathway
HSIAO LIVER SPECIFIC GENES 244 154 All SZGR 2.0 genes in this pathway
SU LIVER 55 32 All SZGR 2.0 genes in this pathway
KONDO PROSTATE CANCER WITH H3K27ME3 196 93 All SZGR 2.0 genes in this pathway
BOCHKIS FOXA2 TARGETS 425 261 All SZGR 2.0 genes in this pathway
CHIANG LIVER CANCER SUBCLASS CTNNB1 DN 170 105 All SZGR 2.0 genes in this pathway
COULOUARN TEMPORAL TGFB1 SIGNATURE DN 138 99 All SZGR 2.0 genes in this pathway
HOSHIDA LIVER CANCER SURVIVAL DN 113 76 All SZGR 2.0 genes in this pathway
CAIRO HEPATOBLASTOMA DN 267 160 All SZGR 2.0 genes in this pathway
SERVITJA LIVER HNF1A TARGETS DN 157 105 All SZGR 2.0 genes in this pathway
NABA ECM REGULATORS 238 125 All SZGR 2.0 genes in this pathway
NABA MATRISOME ASSOCIATED 753 411 All SZGR 2.0 genes in this pathway
NABA MATRISOME 1028 559 All SZGR 2.0 genes in this pathway

Section VI. microRNA annotation

miRNA family Target position miRNA ID miRNA seq
UTR start UTR end Match method
miR-143 1135 1142 1A,m8 hsa-miR-143brain UGAGAUGAAGCACUGUAGCUCA
miR-186 1185 1191 1A hsa-miR-186 CAAAGAAUUCUCCUUUUGGGCUU
miR-224 1082 1088 m8 hsa-miR-224 CAAGUCACUAGUGGUUCCGUUUA
miR-375 929 935 1A hsa-miR-375 UUUGUUCGUUCGGCUCGCGUGA