Gene Page:KCNIP1
Summary?
| GeneID | 30820 |
| Symbol | KCNIP1 |
| Synonyms | KCHIP1|VABP |
| Description | potassium voltage-gated channel interacting protein 1 |
| Reference | MIM:604660|HGNC:HGNC:15521|Ensembl:ENSG00000182132|HPRD:06879|Vega:OTTHUMG00000130442 |
| Gene type | protein-coding |
| Map location | 5q35.1 |
| Pascal p-value | 0.231 |
| Sherlock p-value | 1.261E-4 |
| DMG | 1 (# studies) |
Gene in Data Sources
| Gene set name | Method of gene set | Description | Info |
|---|---|---|---|
| CV:GWASdb | Genome-wide Association Studies | GWASdb records for schizophrenia | |
| CV:PGCnp | Genome-wide Association Study | GWAS | |
| DMG:Wockner_2014 | Genome-wide DNA methylation analysis | This dataset includes 4641 differentially methylated probes corresponding to 2929 unique genes between schizophrenia patients (n=24) and controls (n=24). | 1 |
| PMID:cooccur | High-throughput literature-search | 系统搜索PubMed co-o基因ccurring with SCZ keywords. A total of 3027 genes were included. | |
| GSMA_IIA | Genome scan meta-analysis (All samples) | Psr: 0.0276 | |
| Literature | High-throughput literature-search | Co-occurance with Schizophrenia keywords: schizophrenia,schizophrenias | Click to show details |
| GO_Annotation | Mapping neuro-related keywords to Gene Ontology annotations | Hits with neuro-related keywords: 1 |
Section I. Genetics and epigenetics annotation
Differentially methylated gene
Differentially methylated gene| Probe | Chromosome | Position | Nearest gene | P (dis) | Beta (dis) | FDR (dis) | Study |
|---|---|---|---|---|---|---|---|
| cg13608171 | 5 | 169931831 | KCNIP1 | 1.288E-4 | 0.47 | 0.03 | DMG:Wockner_2014 |
Section II. Transcriptome annotation
General gene expression (GTEx)
Gene expression of temporal and spatial changes (BrainSpan)
Footnote:
SC: sub-cortical regions; SM: sensory-motor regions; FC: frontal cortex; and TP: temporal-parietal cortex
ST1: fetal (13 - 26 postconception weeks), ST2: early infancy to late childhood (4 months to 11 years), and ST3: adolescence to adulthood (13 - 23 years)
The bar shown representes the lower 25% and upper 25% of the expression distribution.
Top co-expressed genes in brain regions
| Top 10 positively co-expressed genes | ||
| Gene | Pearson's Correlation | Spearman's Correlation |
| ZNF238 | 0.95 | 0.91 |
| FRMD3 | 0.94 | 0.94 |
| EML1 | 0.93 | 0.90 |
| SSBP2 | 0.93 | 0.93 |
| DAB1 | 0.92 | 0.94 |
| TMEM108 | 0.92 | 0.92 |
| BCL7A | 0.92 | 0.95 |
| LRCH1 | 0.91 | 0.90 |
| KLHL1 | 0.91 | 0.93 |
| PAK7 | 0.91 | 0.94 |
| Top 10 negatively co-expressed genes | ||
| Gene | Pearson's Correlation | Spearman's Correlation |
| SERPINB6 | -0.68 | -0.80 |
| FBXO2 | -0.65 | -0.68 |
| HEPN1 | -0.65 | -0.83 |
| AIFM3 | -0.64 | -0.84 |
| HLA-F | -0.64 | -0.84 |
| LHPP | -0.64 | -0.65 |
| ALDOC | -0.64 | -0.77 |
| C5orf53 | -0.64 | -0.79 |
| LDHD | -0.64 | -0.71 |
| CLU | -0.64 | -0.77 |
Section III. Gene Ontology annotation
| Molecular function | 去的术语 | Evidence | Neuro keywords | PubMed ID |
|---|---|---|---|---|
| GO:0005509 | calcium ion binding | IEA | - | |
| GO:0005244 | voltage-gated ion channel activity | IEA | - | |
| GO:0005267 | potassium channel activity | IEA | - | |
| GO:0005216 | ion channel activity | IEA | - | |
| GO:0030955 | potassium ion binding | IEA | - | |
| Biological process | 去的术语 | Evidence | Neuro keywords | PubMed ID |
| GO:0007268 | synaptic transmission | TAS | neuron, Synap, Neurotransmitter (GO term level: 6) | 10676964 |
| GO:0005513 | detection of calcium ion | TAS | 10676964 | |
| GO:0007165 | signal transduction | TAS | 10676964 | |
| GO:0006811 | ion transport | IEA | - | |
| GO:0006813 | potassium ion transport | IEA | - | |
| Cellular component | 去的术语 | Evidence | Neuro keywords | PubMed ID |
| GO:0005886 | plasma membrane | IEA | - |
Section V. Pathway annotation
| Pathway name | Pathway size | # SZGR 2.0 genes in pathway | Info |
|---|---|---|---|
| MOREAUX MULTIPLE MYELOMA BY TACI UP | 412 | 249 | All SZGR 2.0 genes in this pathway |
| BLALOCK ALZHEIMERS DISEASE DN | 1237 | 837 | All SZGR 2.0 genes in this pathway |
| BLALOCK ALZHEIMERS DISEASE INCIPIENT DN | 165 | 106 | All SZGR 2.0 genes in this pathway |
| ACEVEDO LIVER CANCER WITH H3K27ME3 DN | 228 | 114 | All SZGR 2.0 genes in this pathway |
| MEISSNER NPC HCP WITH H3 UNMETHYLATED | 536 | 296 | All SZGR 2.0 genes in this pathway |
| MIKKELSEN IPS WITH HCP H3K27ME3 | 102 | 76 | All SZGR 2.0 genes in this pathway |
| MIKKELSEN ES HCP WITH H3K27ME3 | 41 | 30 | All SZGR 2.0 genes in this pathway |
| MIKKELSEN MEF HCP WITH H3K27ME3 | 590 | 403 | All SZGR 2.0 genes in this pathway |
| KRIEG HYPOXIA NOT VIA KDM3A | 770 | 480 | All SZGR 2.0 genes in this pathway |
| PEDRIOLI MIR31 TARGETS DN | 418 | 245 | All SZGR 2.0 genes in this pathway |
| ACEVEDO FGFR1 TARGETS IN PROSTATE CANCER MODEL DN | 308 | 187 | All SZGR 2.0 genes in this pathway |
Section VI. microRNA annotation
| miRNA family | Target position | miRNA ID | miRNA seq | ||
|---|---|---|---|---|---|
| UTR start | UTR end | Match method | |||
| miR-150 | 507 | 514 | 1A,m8 | hsa-miR-150 | UCUCCCAACCCUUGUACCAGUG |
- SZ: miRNAs which differentially expressed in brain cortex of schizophrenia patients comparing with control samples using microarray. Clickhereto see the list of SZ related miRNAs.
- Brain: miRNAs which are expressed in brain based on miRNA microarray expression studies. Clickhereto see the list of brain related miRNAs.