Gene Page:HHEX

Summary?
GeneID 3087
Symbol HHEX
Synonyms HEX|HMPH|HOX11L-PEN|PRH|PRHX
Description hematopoietically expressed homeobox
Reference MIM:604420|HGNC:HGNC:4901|Ensembl:ENSG00000152804|HPRD:06829|Vega:OTTHUMG00000018762
Gene type protein-coding
Map location 10q23.33
Pascal p-value 0.36
Fetal beta -0.079
DMG 2 (# studies)

Gene in Data Sources
Gene set name Method of gene set Description Info
CV:PGCnp Genome-wide Association Study GWAS
DMG:Jaffe_2016 Genome-wide DNA methylation analysis This dataset includes 2,104 probes/CpGs associated with SZ patients (n=108) compared to 136 controls at Bonferroni-adjusted P < 0.05. 2
DMG:Wockner_2014 Genome-wide DNA methylation analysis This dataset includes 4641 differentially methylated probes corresponding to 2929 unique genes between schizophrenia patients (n=24) and controls (n=24). 2
GO_Annotation Mapping neuro-related keywords to Gene Ontology annotations Hits with neuro-related keywords: 1

Section I. Genetics and epigenetics annotation

@Differentially methylated gene

Probe Chromosome Position Nearest gene P (dis) Beta (dis) FDR (dis) Study
cg18599843 10 94450994 HHEX 5.644E-4 0.337 0.049 DMG:Wockner_2014
cg12865381 10 94459447 HHEX 4.97E-9 -0.017 2.84E-6 DMG:Jaffe_2016


Section II. Transcriptome annotation

General gene expression (GTEx)

Not available

Gene expression during devlopment (BrainCloud)

Footnote:
A total of 269 time points ploted, with n=38 fetal samples (x=1:38). Each triangle represents one time point.

Gene expression of temporal and spatial changes (BrainSpan)

Footnote:
SC: sub-cortical regions; SM: sensory-motor regions; FC: frontal cortex; and TP: temporal-parietal cortex
ST1: fetal (13 - 26 postconception weeks), ST2: early infancy to late childhood (4 months to 11 years), and ST3: adolescence to adulthood (13 - 23 years)
The bar shown representes the lower 25% and upper 25% of the expression distribution.

Top co-expressed genes in brain regions

Top 10 positively co-expressed genes
Gene Pearson's Correlation Spearman's Correlation
HLA-B 0.85 0.76
BST2 0.83 0.63
IFI6 0.82 0.65
TAP1 0.81 0.72
ISG15 0.80 0.60
HLA-G 0.79 0.58
PARP12 0.77 0.67
TNFRSF1A 0.77 0.68
SLC15A3 0.77 0.68
IFITM1 0.76 0.63
Top 10 negatively co-expressed genes
Gene Pearson's Correlation Spearman's Correlation
RTF1 -0.51 -0.59
CCAR1 -0.50 -0.60
ZNF485 -0.48 -0.58
DNAJC2 -0.48 -0.54
ZNF841 -0.48 -0.56
THOC2 -0.48 -0.59
UPF3B -0.48 -0.59
TCERG1 -0.48 -0.54
NOP58 -0.48 -0.55
GGNBP2 -0.48 -0.55

Section III. Gene Ontology annotation

Molecular function 去的术语 Evidence Neuro keywords PubMed ID
GO:0003700 transcription factor activity TAS 10871399
去:0008134 转录因子结合素g 新闻学会 15016828
GO:0008190 eukaryotic initiation factor 4E binding IDA 12554669
GO:0016564 transcription repressor activity ISS -
GO:0043565 sequence-specific DNA binding ISS -
Biological process 去的术语 Evidence Neuro keywords PubMed ID
GO:0030900 forebrain development IEA Brain (GO term level: 8) -
GO:0001889 liver development IEA -
GO:0006355 regulation of transcription, DNA-dependent IEA -
GO:0006406 mRNA export from nucleus IDA 12554669
GO:0010553 negative regulation of specific transcription from RNA polymerase II promoter IDA 10871399|15016828
GO:0010552 positive regulation of specific transcription from RNA polymerase II promoter IDA 12655000
GO:0009952 anterior/posterior pattern formation ISS -
: 0007049 cell cycle IDA 12554669
: 0007275 multicellular organismal development IEA -
GO:0030177 positive regulation of Wnt receptor signaling pathway ISS -
GO:0030154 cell differentiation IEA -
去:0016525 negative regulation of angiogenesis IDA 15016828
GO:0042127 regulation of cell proliferation IEA -
GO:0030948 negative regulation of vascular endothelial growth factor receptor signaling pathway IDA 15016828
GO:0030878 thyroid gland development IEA -
GO:0035050 embryonic heart tube development IEA -
Cellular component 去的术语 Evidence Neuro keywords PubMed ID
GO:0005634 nucleus ISS -
GO:0005737 cytoplasm IDA 12554669|12826010

Section V. Pathway annotation

Pathway name Pathway size # SZGR 2.0 genes in pathway Info
KEGG MATURITY ONSET DIABETES OF THE YOUNG 25 19 All SZGR 2.0 genes in this pathway
ZHOU INFLAMMATORY RESPONSE LIVE DN 384 220 All SZGR 2.0 genes in this pathway
ZHOU INFLAMMATORY RESPONSE FIMA DN 284 156 All SZGR 2.0 genes in this pathway
ELVIDGE HYPOXIA DN 146 94 All SZGR 2.0 genes in this pathway
ELVIDGE HIF1A TARGETS UP 67 40 All SZGR 2.0 genes in this pathway
JAATINEN HEMATOPOIETIC STEM CELL UP 316 190 All SZGR 2.0 genes in this pathway
DODD NASOPHARYNGEAL CARCINOMA UP 1821 933 All SZGR 2.0 genes in this pathway
RODRIGUES THYROID CARCINOMA POORLY DIFFERENTIATED DN 805 505 All SZGR 2.0 genes in this pathway
RODRIGUES THYROID CARCINOMA ANAPLASTIC DN 537 339 All SZGR 2.0 genes in this pathway
GOZGIT ESR1 TARGETS DN 781 465 All SZGR 2.0 genes in this pathway
DELYS THYROID CANCER DN 232 154 All SZGR 2.0 genes in this pathway
RASHI RESPONSE TO IONIZING RADIATION 6 84 54 All SZGR 2.0 genes in this pathway
LINDGREN BLADDER CANCER CLUSTER 2B 392 251 All SZGR 2.0 genes in this pathway
LUI THYROID CANCER CLUSTER 1 51 33 All SZGR 2.0 genes in this pathway
HERNANDEZ MITOTIC ARREST BY DOCETAXEL 2 UP 64 45 All SZGR 2.0 genes in this pathway
DACOSTA UV RESPONSE VIA ERCC3 UP 309 199 All SZGR 2.0 genes in this pathway
GRUETZMANN PANCREATIC CANCER DN 203 134 All SZGR 2.0 genes in this pathway
BUYTAERT PHOTODYNAMIC THERAPY STRESS DN 637 377 All SZGR 2.0 genes in this pathway
PASQUALUCCI LYMPHOMA BY GC STAGE DN 165 104 All SZGR 2.0 genes in this pathway
BENPORATH NANOG TARGETS 988 594 All SZGR 2.0 genes in this pathway
BENPORATH OCT4 TARGETS 290 172 All SZGR 2.0 genes in this pathway
BENPORATH SOX2 TARGETS 734 436 All SZGR 2.0 genes in this pathway
BENPORATH NOS TARGETS 179 105 All SZGR 2.0 genes in this pathway
BENPORATH SUZ12 TARGETS 1038 678 All SZGR 2.0 genes in this pathway
BENPORATH EED TARGETS 1062 725 All SZGR 2.0 genes in this pathway
BENPORATH ES WITH H3K27ME3 1118 744 All SZGR 2.0 genes in this pathway
BENPORATH PRC2 TARGETS 652 441 All SZGR 2.0 genes in this pathway
SHIN B CELL LYMPHOMA CLUSTER 3 28 23 All SZGR 2.0 genes in this pathway
BASSO B LYMPHOCYTE NETWORK 143 96 All SZGR 2.0 genes in this pathway
TARTE PLASMA CELL VS PLASMABLAST UP 398 262 All SZGR 2.0 genes in this pathway
TARTE PLASMA CELL VS B LYMPHOCYTE DN 38 25 All SZGR 2.0 genes in this pathway
FERRANDO LYL1 NEIGHBORS 15 12 All SZGR 2.0 genes in this pathway
THEILGAARD NEUTROPHIL AT SKIN WOUND DN 225 163 All SZGR 2.0 genes in this pathway
ZHAN MULTIPLE MYELOMA DN 41 27 All SZGR 2.0 genes in this pathway
CUI TCF21 TARGETS 2 DN 830 547 All SZGR 2.0 genes in this pathway
MCCOLLUM GELDANAMYCIN RESISTANCE DN 7 6 All SZGR 2.0 genes in this pathway
FOSTER TOLERANT MACROPHAGE DN 409 268 All SZGR 2.0 genes in this pathway
ACEVEDO NORMAL TISSUE ADJACENT TO LIVER TUMOR UP 174 96 All SZGR 2.0 genes in this pathway
SMID BREAST CANCER NORMAL LIKE UP 476 285 All SZGR 2.0 genes in this pathway
萧述三乳腺癌基本DN 701 446 All SZGR 2.0 genes in this pathway
BOQUEST STEM CELL DN 216 143 All SZGR 2.0 genes in this pathway
LABBE WNT3A TARGETS UP 112 71 All SZGR 2.0 genes in this pathway
ZHOU PANCREATIC EXOCRINE PROGENITOR 11 10 All SZGR 2.0 genes in this pathway
SWEET LUNG CANCER KRAS UP 491 316 All SZGR 2.0 genes in this pathway
MEISSNER BRAIN HCP WITH H3K4ME3 AND H3K27ME3 1069 729 All SZGR 2.0 genes in this pathway
SCHOEN NFKB SIGNALING 34 26 All SZGR 2.0 genes in this pathway
LI INDUCED T TO NATURAL KILLER UP 307 182 All SZGR 2.0 genes in this pathway
CHICAS RB1 TARGETS CONFLUENT 567 365 All SZGR 2.0 genes in this pathway
PILON KLF1 TARGETS DN 1972 1213 All SZGR 2.0 genes in this pathway
TORCHIA TARGETS OF EWSR1 FLI1 FUSION UP 271 165 All SZGR 2.0 genes in this pathway
HUANG GATA2 TARGETS UP 149 96 All SZGR 2.0 genes in this pathway
PHONG TNF RESPONSE VIA P38 COMPLETE 227 151 All SZGR 2.0 genes in this pathway
SMIRNOV RESPONSE TO IR 6HR DN 114 69 All SZGR 2.0 genes in this pathway

Section VI. microRNA annotation

miRNA family Target position miRNA ID miRNA seq
UTR start UTR end Match method
miR-223 671 677 m8 hsa-miR-223 UGUCAGUUUGUCAAAUACCCC