Gene Page:HIP1
Summary?
GeneID | 3092 |
Symbol | HIP1 |
Synonyms | HIP-I|ILWEQ|SHON|SHONbeta|SHONgamma |
Description | huntingtin interacting protein 1 |
Reference | MIM:601767|HGNC:HGNC:4913|Ensembl:ENSG00000127946|HPRD:03461|Vega:OTTHUMG00000156050 |
Gene type | protein-coding |
Map location | 7q11.23 |
Pascal p-value | 0.291 |
Sherlock p-value | 0.832 |
DEG p-value | DEG:Zhao_2015:p=1.55e-04:q=0.0745 |
Fetal beta | 0.71 |
eGene | Myers' cis & trans |
Support | Ascano FMRP targets |
Gene in Data Sources
Gene set name | Method of gene set | Description | Info |
---|---|---|---|
CV:PGCnp | Genome-wide Association Study | GWAS | |
DEG:Zhao_2015 | RNA Sequencing analysis | Transcriptome sequencing and genome-wide association analyses reveal lysosomal function and actin cytoskeleton remodeling in schizophrenia and bipolar disorder. | |
GO_Annotation | Mapping neuro-related keywords to Gene Ontology annotations | Hits with neuro-related keywords: 1 |
Section I. Genetics and epigenetics annotation
eQTL annotation
SNP ID | Chromosome | Position | eGene | Gene Entrez ID | pvalue | qvalue | TSS distance | eQTL type |
---|---|---|---|---|---|---|---|---|
rs869535 | chr4 | 109331957 | HIP1 | 3092 | 0.05 | trans |
Section II. Transcriptome annotation
General gene expression (GTEx)
![Not available](http://www.tjghsg.com/bioinfo/SZGR/GeneImg/HIP1_DE_GTEx.png)
Gene expression during devlopment (BrainCloud)
Footnote:
A total of 269 time points ploted, with n=38 fetal samples (x=1:38). Each triangle represents one time point.
Gene expression of temporal and spatial changes (BrainSpan)
Footnote:
SC: sub-cortical regions; SM: sensory-motor regions; FC: frontal cortex; and TP: temporal-parietal cortex
ST1: fetal (13 - 26 postconception weeks), ST2: early infancy to late childhood (4 months to 11 years), and ST3: adolescence to adulthood (13 - 23 years)
The bar shown representes the lower 25% and upper 25% of the expression distribution.
No co-expressed genes in brain regions
Section III. Gene Ontology annotation
Molecular function | GO term | Evidence | Neuro keywords | PubMed ID |
---|---|---|---|---|
GO:0030276 | clathrin binding | IDA | Synap(术语级别:4) | 11577110 |
GO:0003779 | actin binding | IEA | - | |
GO:0005543 | phospholipid binding | IEA | - | |
GO:0005200 | structural constituent of cytoskeleton | TAS | 9140394 | |
Biological process | GO term | Evidence | Neuro keywords | PubMed ID |
GO:0006919 | caspase activation | IDA | 11788820 | |
GO:0006897 | endocytosis | IDA | 11577110|11604514 | |
GO:0042981 | regulation of apoptosis | IDA | 11788820 | |
GO:0048268 | clathrin coat assembly | IDA | 11577110 | |
Cellular component | GO term | Evidence | Neuro keywords | PubMed ID |
GO:0012505 | endomembrane system | IEA | - | |
GO:0005794 | Golgi apparatus | IDA | 11788820 | |
GO:0005856 | cytoskeleton | TAS | 9147654 | |
GO:0005624 | membrane fraction | TAS | 9147654 | |
GO:0005737 | cytoplasm | IDA | 11604514 | |
GO:0016020 | membrane | IEA | - |
Section IV. Protein-protein interaction annotation
Interactors | Aliases B | Official full name B | Experimental | Source | PubMed ID |
---|---|---|---|---|---|
AP2A1 | ADTAA | AP2-ALPHA | CLAPA1 | adaptor-related protein complex 2, alpha 1 subunit | - | HPRD | 11517213|11532990|11532990 |
AP2A1 | ADTAA | AP2-ALPHA | CLAPA1 | adaptor-related protein complex 2, alpha 1 subunit | - | HPRD,BioGRID | 11532990 |
CASP8 | ALPS2B | CAP4 | FLICE | FLJ17672 | MACH | MCH5 | MGC78473 | caspase 8, apoptosis-related cysteine peptidase | - | HPRD,BioGRID | 11788820 |
CLTA | LCA | clathrin, light chain (Lca) | - | HPRD | 11889126 |
CLTB | LCB | clathrin, light chain (Lcb) | - | HPRD | 1189126 |
CLTC | CHC | CHC17 | CLH-17 | CLTCL2 | Hc | KIAA0034 | clathrin, heavy chain (Hc) | HIP1 interacts with Clathrin-HC (Clathrin heavy chain). | BIND | 11517213 |
CLTC | CHC | CHC17 | CLH-17 | CLTCL2 | Hc | KIAA0034 | clathrin, heavy chain (Hc) | - | HPRD,BioGRID | 11532990 |
EIF6 | 2 | CAB | EIF3A | ITGB4BP | b | b(2)gcn | gcn | p27BBP | eukaryotic translation initiation factor 6 | Two-hybrid | BioGRID | 16169070 |
HIP1 | ILWEQ | MGC126506 | huntingtin interacting protein 1 | - | HPRD | 11063258 |
HIP1 | ILWEQ | MGC126506 | huntingtin interacting protein 1 | HIP1 interacts with itself. | BIND | 11063258 |
HIP1R | FLJ14000 | FLJ27022 | HIP12 | HIP3 | ILWEQ | KIAA0655 | MGC47513 | huntingtin interacting protein 1 related | - | HPRD | 11063258 |
HIP1R | FLJ14000 | FLJ27022 | HIP12 | HIP3 | ILWEQ | KIAA0655 | MGC47513 | huntingtin interacting protein 1 related | - | HPRD,BioGRID | 11063258|11889126 |
HIP1R | FLJ14000 | FLJ27022 | HIP12 | HIP3 | ILWEQ | KIAA0655 | MGC47513 | huntingtin interacting protein 1 related | HIP1 interacts with HIP12. | BIND | 11063258 |
HTT | HD | IT15 | huntingtin | - | HPRD,BioGRID | 9147654|11063258 |
HTT | HD | IT15 | huntingtin | HIP1 interacts with HD. | BIND | 11063258 |
IFT57 | ESRRBL1 | FLJ10147 | HIPPI | MHS4R2 | intraflagellar transport 57 homolog (Chlamydomonas) | - | HPRD,BioGRID | 11788820 |
PFDN1 | PDF | PFD1 | prefoldin subunit 1 | Two-hybrid | BioGRID | 16169070 |
RPS10 | MGC88819 | ribosomal protein S10 | Two-hybrid | BioGRID | 16169070 |
Section V. Pathway annotation
Pathway name | Pathway size | # SZGR 2.0 genes in pathway | Info |
---|---|---|---|
KEGG HUNTINGTONS DISEASE | 185 | 109 | All SZGR 2.0 genes in this pathway |
PID AR PATHWAY | 61 | 46 | All SZGR 2.0 genes in this pathway |
FULCHER INFLAMMATORY RESPONSE LECTIN VS LPS UP | 579 | 346 | All SZGR 2.0 genes in this pathway |
MULLIGHAN MLL SIGNATURE 2 UP | 418 | 263 | All SZGR 2.0 genes in this pathway |
TONKS TARGETS OF RUNX1 RUNX1T1 FUSION MONOCYTE DN | 54 | 38 | All SZGR 2.0 genes in this pathway |
SENESE HDAC1 AND HDAC2 TARGETS UP | 238 | 144 | All SZGR 2.0 genes in this pathway |
DODD NASOPHARYNGEAL CARCINOMA DN | 1375 | 806 | All SZGR 2.0 genes in this pathway |
DELYS THYROID CANCER UP | 443 | 294 | All SZGR 2.0 genes in this pathway |
LINDGREN BLADDER CANCER CLUSTER 1 DN | 378 | 231 | All SZGR 2.0 genes in this pathway |
GRAESSMANN APOPTOSIS BY DOXORUBICIN DN | 1781 | 1082 | All SZGR 2.0 genes in this pathway |
GRAESSMANN RESPONSE TO MC AND DOXORUBICIN DN | 770 | 415 | All SZGR 2.0 genes in this pathway |
WEI MIR34A TARGETS | 148 | 97 | All SZGR 2.0 genes in this pathway |
MORI EMU MYC LYMPHOMA BY ONSET TIME DN | 17 | 9 | All SZGR 2.0 genes in this pathway |
MATSUDA NATURAL KILLER DIFFERENTIATION | 475 | 313 | All SZGR 2.0 genes in this pathway |
VERHAAK AML WITH NPM1 MUTATED UP | 183 | 111 | All SZGR 2.0 genes in this pathway |
CUI TCF21 TARGETS 2 DN | 830 | 547 | All SZGR 2.0 genes in this pathway |
DELASERNA MYOD TARGETS UP | 89 | 51 | All SZGR 2.0 genes in this pathway |
DOUGLAS BMI1 TARGETS UP | 566 | 371 | All SZGR 2.0 genes in this pathway |
KRIGE RESPONSE TO TOSEDOSTAT 6HR UP | 953 | 554 | All SZGR 2.0 genes in this pathway |
KRIGE RESPONSE TO TOSEDOSTAT 24HR UP | 783 | 442 | All SZGR 2.0 genes in this pathway |
AMUNDSON POOR SURVIVAL AFTER GAMMA RADIATION 2G | 171 | 96 | All SZGR 2.0 genes in this pathway |
MASSARWEH TAMOXIFEN RESISTANCE DN | 258 | 160 | All SZGR 2.0 genes in this pathway |
IWANAGA CARCINOGENESIS BY KRAS PTEN DN | 353 | 226 | All SZGR 2.0 genes in this pathway |
BERNARD PPAPDC1B TARGETS DN | 58 | 39 | All SZGR 2.0 genes in this pathway |
ZHENG GLIOBLASTOMA PLASTICITY UP | 250 | 168 | All SZGR 2.0 genes in this pathway |
MATZUK SPERMATID DIFFERENTIATION | 37 | 26 | All SZGR 2.0 genes in this pathway |
GRESHOCK CANCER COPY NUMBER UP | 323 | 240 | All SZGR 2.0 genes in this pathway |
BOYAULT LIVER CANCER SUBCLASS G2 | 27 | 17 | All SZGR 2.0 genes in this pathway |
YAGI AML WITH 11Q23 REARRANGED | 351 | 238 | All SZGR 2.0 genes in this pathway |
CAIRO HEPATOBLASTOMA UP | 207 | 143 | All SZGR 2.0 genes in this pathway |
MARTENS BOUND BY PML RARA FUSION | 456 | 287 | All SZGR 2.0 genes in this pathway |
CHICAS RB1 TARGETS SENESCENT | 572 | 352 | All SZGR 2.0 genes in this pathway |
MIYAGAWA TARGETS OF EWSR1 ETS FUSIONS DN | 229 | 135 | All SZGR 2.0 genes in this pathway |
Section VI. microRNA annotation
miRNA family | Target position | miRNA ID | miRNA seq | ||
---|---|---|---|---|---|
UTR start | UTR end | Match method | |||
miR-124/506 | 875 | 881 | m8 | hsa-miR-506 | UAAGGCACCCUUCUGAGUAGA |
hsa-miR-124brain | UAAGGCACGCGGUGAAUGCC | ||||
miR-128 | 1787 | 1794 | 1A,m8 | hsa-miR-128a | UCACAGUGAACCGGUCUCUUUU |
hsa-miR-128b | UCACAGUGAACCGGUCUCUUUC | ||||
miR-27 | 1788 | 1795 | 1A,m8 | hsa-miR-27abrain | UUCACAGUGGCUAAGUUCCGC |
hsa-miR-27bbrain | UUCACAGUGGCUAAGUUCUGC |