Gene Page:HIP1

Summary?
GeneID 3092
Symbol HIP1
Synonyms HIP-I|ILWEQ|SHON|SHONbeta|SHONgamma
Description huntingtin interacting protein 1
Reference MIM:601767|HGNC:HGNC:4913|Ensembl:ENSG00000127946|HPRD:03461|Vega:OTTHUMG00000156050
Gene type protein-coding
Map location 7q11.23
Pascal p-value 0.291
Sherlock p-value 0.832
DEG p-value DEG:Zhao_2015:p=1.55e-04:q=0.0745
Fetal beta 0.71
eGene Myers' cis & trans
Support Ascano FMRP targets

Gene in Data Sources
Gene set name Method of gene set Description Info
CV:PGCnp Genome-wide Association Study GWAS
DEG:Zhao_2015 RNA Sequencing analysis Transcriptome sequencing and genome-wide association analyses reveal lysosomal function and actin cytoskeleton remodeling in schizophrenia and bipolar disorder.
GO_Annotation Mapping neuro-related keywords to Gene Ontology annotations Hits with neuro-related keywords: 1

Section I. Genetics and epigenetics annotation

@eQTL annotation

SNP ID Chromosome Position eGene Gene Entrez ID pvalue qvalue TSS distance eQTL type
rs869535 chr4 109331957 HIP1 3092 0.05 trans

Section II. Transcriptome annotation

General gene expression (GTEx)

Not available

Gene expression during devlopment (BrainCloud)

Footnote:
A total of 269 time points ploted, with n=38 fetal samples (x=1:38). Each triangle represents one time point.

Gene expression of temporal and spatial changes (BrainSpan)

Footnote:
SC: sub-cortical regions; SM: sensory-motor regions; FC: frontal cortex; and TP: temporal-parietal cortex
ST1: fetal (13 - 26 postconception weeks), ST2: early infancy to late childhood (4 months to 11 years), and ST3: adolescence to adulthood (13 - 23 years)
The bar shown representes the lower 25% and upper 25% of the expression distribution.

No co-expressed genes in brain regions


Section III. Gene Ontology annotation

Molecular function GO term Evidence Neuro keywords PubMed ID
GO:0030276 clathrin binding IDA Synap(术语级别:4) 11577110
GO:0003779 actin binding IEA -
GO:0005543 phospholipid binding IEA -
GO:0005200 structural constituent of cytoskeleton TAS 9140394
Biological process GO term Evidence Neuro keywords PubMed ID
GO:0006919 caspase activation IDA 11788820
GO:0006897 endocytosis IDA 11577110|11604514
GO:0042981 regulation of apoptosis IDA 11788820
GO:0048268 clathrin coat assembly IDA 11577110
Cellular component GO term Evidence Neuro keywords PubMed ID
GO:0012505 endomembrane system IEA -
GO:0005794 Golgi apparatus IDA 11788820
GO:0005856 cytoskeleton TAS 9147654
GO:0005624 membrane fraction TAS 9147654
GO:0005737 cytoplasm IDA 11604514
GO:0016020 membrane IEA -

Section IV. Protein-protein interaction annotation

Interactors Aliases B Official full name B Experimental Source PubMed ID
AP2A1 ADTAA | AP2-ALPHA | CLAPA1 adaptor-related protein complex 2, alpha 1 subunit - HPRD 11517213|11532990|11532990
AP2A1 ADTAA | AP2-ALPHA | CLAPA1 adaptor-related protein complex 2, alpha 1 subunit - HPRD,BioGRID 11532990
CASP8 ALPS2B | CAP4 | FLICE | FLJ17672 | MACH | MCH5 | MGC78473 caspase 8, apoptosis-related cysteine peptidase - HPRD,BioGRID 11788820
CLTA LCA clathrin, light chain (Lca) - HPRD 11889126
CLTB LCB clathrin, light chain (Lcb) - HPRD 1189126
CLTC CHC | CHC17 | CLH-17 | CLTCL2 | Hc | KIAA0034 clathrin, heavy chain (Hc) HIP1 interacts with Clathrin-HC (Clathrin heavy chain). BIND 11517213
CLTC CHC | CHC17 | CLH-17 | CLTCL2 | Hc | KIAA0034 clathrin, heavy chain (Hc) - HPRD,BioGRID 11532990
EIF6 2 | CAB | EIF3A | ITGB4BP | b | b(2)gcn | gcn | p27BBP eukaryotic translation initiation factor 6 Two-hybrid BioGRID 16169070
HIP1 ILWEQ | MGC126506 huntingtin interacting protein 1 - HPRD 11063258
HIP1 ILWEQ | MGC126506 huntingtin interacting protein 1 HIP1 interacts with itself. BIND 11063258
HIP1R FLJ14000 | FLJ27022 | HIP12 | HIP3 | ILWEQ | KIAA0655 | MGC47513 huntingtin interacting protein 1 related - HPRD 11063258
HIP1R FLJ14000 | FLJ27022 | HIP12 | HIP3 | ILWEQ | KIAA0655 | MGC47513 huntingtin interacting protein 1 related - HPRD,BioGRID 11063258|11889126
HIP1R FLJ14000 | FLJ27022 | HIP12 | HIP3 | ILWEQ | KIAA0655 | MGC47513 huntingtin interacting protein 1 related HIP1 interacts with HIP12. BIND 11063258
HTT HD | IT15 huntingtin - HPRD,BioGRID 9147654|11063258
HTT HD | IT15 huntingtin HIP1 interacts with HD. BIND 11063258
IFT57 ESRRBL1 | FLJ10147 | HIPPI | MHS4R2 intraflagellar transport 57 homolog (Chlamydomonas) - HPRD,BioGRID 11788820
PFDN1 PDF | PFD1 prefoldin subunit 1 Two-hybrid BioGRID 16169070
RPS10 MGC88819 ribosomal protein S10 Two-hybrid BioGRID 16169070


Section V. Pathway annotation

Pathway name Pathway size # SZGR 2.0 genes in pathway Info
KEGG HUNTINGTONS DISEASE 185 109 All SZGR 2.0 genes in this pathway
PID AR PATHWAY 61 46 All SZGR 2.0 genes in this pathway
FULCHER INFLAMMATORY RESPONSE LECTIN VS LPS UP 579 346 All SZGR 2.0 genes in this pathway
MULLIGHAN MLL SIGNATURE 2 UP 418 263 All SZGR 2.0 genes in this pathway
TONKS TARGETS OF RUNX1 RUNX1T1 FUSION MONOCYTE DN 54 38 All SZGR 2.0 genes in this pathway
SENESE HDAC1 AND HDAC2 TARGETS UP 238 144 All SZGR 2.0 genes in this pathway
DODD NASOPHARYNGEAL CARCINOMA DN 1375 806 All SZGR 2.0 genes in this pathway
DELYS THYROID CANCER UP 443 294 All SZGR 2.0 genes in this pathway
LINDGREN BLADDER CANCER CLUSTER 1 DN 378 231 All SZGR 2.0 genes in this pathway
GRAESSMANN APOPTOSIS BY DOXORUBICIN DN 1781 1082 All SZGR 2.0 genes in this pathway
GRAESSMANN RESPONSE TO MC AND DOXORUBICIN DN 770 415 All SZGR 2.0 genes in this pathway
WEI MIR34A TARGETS 148 97 All SZGR 2.0 genes in this pathway
MORI EMU MYC LYMPHOMA BY ONSET TIME DN 17 9 All SZGR 2.0 genes in this pathway
MATSUDA NATURAL KILLER DIFFERENTIATION 475 313 All SZGR 2.0 genes in this pathway
VERHAAK AML WITH NPM1 MUTATED UP 183 111 All SZGR 2.0 genes in this pathway
CUI TCF21 TARGETS 2 DN 830 547 All SZGR 2.0 genes in this pathway
DELASERNA MYOD TARGETS UP 89 51 All SZGR 2.0 genes in this pathway
DOUGLAS BMI1 TARGETS UP 566 371 All SZGR 2.0 genes in this pathway
KRIGE RESPONSE TO TOSEDOSTAT 6HR UP 953 554 All SZGR 2.0 genes in this pathway
KRIGE RESPONSE TO TOSEDOSTAT 24HR UP 783 442 All SZGR 2.0 genes in this pathway
AMUNDSON POOR SURVIVAL AFTER GAMMA RADIATION 2G 171 96 All SZGR 2.0 genes in this pathway
MASSARWEH TAMOXIFEN RESISTANCE DN 258 160 All SZGR 2.0 genes in this pathway
IWANAGA CARCINOGENESIS BY KRAS PTEN DN 353 226 All SZGR 2.0 genes in this pathway
BERNARD PPAPDC1B TARGETS DN 58 39 All SZGR 2.0 genes in this pathway
ZHENG GLIOBLASTOMA PLASTICITY UP 250 168 All SZGR 2.0 genes in this pathway
MATZUK SPERMATID DIFFERENTIATION 37 26 All SZGR 2.0 genes in this pathway
GRESHOCK CANCER COPY NUMBER UP 323 240 All SZGR 2.0 genes in this pathway
BOYAULT LIVER CANCER SUBCLASS G2 27 17 All SZGR 2.0 genes in this pathway
YAGI AML WITH 11Q23 REARRANGED 351 238 All SZGR 2.0 genes in this pathway
CAIRO HEPATOBLASTOMA UP 207 143 All SZGR 2.0 genes in this pathway
MARTENS BOUND BY PML RARA FUSION 456 287 All SZGR 2.0 genes in this pathway
CHICAS RB1 TARGETS SENESCENT 572 352 All SZGR 2.0 genes in this pathway
MIYAGAWA TARGETS OF EWSR1 ETS FUSIONS DN 229 135 All SZGR 2.0 genes in this pathway

Section VI. microRNA annotation

miRNA family Target position miRNA ID miRNA seq
UTR start UTR end Match method
miR-124/506 875 881 m8 hsa-miR-506 UAAGGCACCCUUCUGAGUAGA
hsa-miR-124brain UAAGGCACGCGGUGAAUGCC
miR-128 1787 1794 1A,m8 hsa-miR-128a UCACAGUGAACCGGUCUCUUUU
hsa-miR-128b UCACAGUGAACCGGUCUCUUUC
miR-27 1788 1795 1A,m8 hsa-miR-27abrain UUCACAGUGGCUAAGUUCCGC
hsa-miR-27bbrain UUCACAGUGGCUAAGUUCUGC