Gene Page:HK3
Summary?
GeneID | 3101 |
Symbol | HK3 |
Synonyms | HKIII|HXK3 |
Description | hexokinase 3 |
Reference | MIM:142570|HGNC:HGNC:4925|Ensembl:ENSG00000160883|HPRD:00806|Vega:OTTHUMG00000130855 |
Gene type | protein-coding |
Map location | 5q35.2 |
Pascal p-value | 0.611 |
Fetal beta | 0.126 |
eGene | Frontal Cortex BA9 |
Gene in Data Sources
Gene set name | Method of gene set | Description | Info |
---|---|---|---|
CV:GWASdb | Genome-wide Association Studies | GWASdb records for schizophrenia | |
CV:PGCnp | Genome-wide Association Study | GWAS | |
PMID:cooccur | High-throughput literature-search | 系统搜索PubMed co-o基因ccurring with SCZ keywords. A total of 3027 genes were included. | |
GSMA_IIA | Genome scan meta-analysis (All samples) | Psr: 0.0276 | |
Literature | High-throughput literature-search | Co-occurance with Schizophrenia keywords: schizophrenia,schizophrenias | Click to show details |
Section I. Genetics and epigenetics annotation
Section II. Transcriptome annotation
General gene expression (GTEx)
![Not available](http://www.tjghsg.com/bioinfo/SZGR/GeneImg/HK3_DE_GTEx.png)
Gene expression during devlopment (BrainCloud)
Footnote:
A total of 269 time points ploted, with n=38 fetal samples (x=1:38). Each triangle represents one time point.
Gene expression of temporal and spatial changes (BrainSpan)
Footnote:
SC: sub-cortical regions; SM: sensory-motor regions; FC: frontal cortex; and TP: temporal-parietal cortex
ST1: fetal (13 - 26 postconception weeks), ST2: early infancy to late childhood (4 months to 11 years), and ST3: adolescence to adulthood (13 - 23 years)
The bar shown representes the lower 25% and upper 25% of the expression distribution.
Top co-expressed genes in brain regions
Top 10 positively co-expressed genes | ||
Gene | Pearson's Correlation | Spearman's Correlation |
HLA-DRB1 | 0.82 | 0.82 |
ISCU | 0.73 | 0.68 |
HLA-DPA1 | 0.72 | 0.79 |
ANXA11 | 0.72 | 0.75 |
CD74 | 0.72 | 0.79 |
HLA-DRA | 0.72 | 0.77 |
GYG1 | 0.71 | 0.77 |
ART3 | 0.71 | 0.62 |
CEBPB | 0.71 | 0.69 |
ATG7 | 0.71 | 0.69 |
Top 10 negatively co-expressed genes | ||
Gene | Pearson's Correlation | Spearman's Correlation |
KIAA1949 | -0.47 | -0.53 |
PDE9A | -0.46 | -0.60 |
SH3BP2 | -0.46 | -0.58 |
TUBB2B | -0.45 | -0.58 |
VAV2 | -0.45 | -0.47 |
NKIRAS2 | -0.45 | -0.44 |
PKN1 | -0.45 | -0.52 |
ZNF311 | -0.45 | -0.50 |
ZNF300 | -0.44 | -0.46 |
ZNF551 | -0.44 | -0.46 |
Section III. Gene Ontology annotation
Molecular function | 去的术语 | Evidence | Neuro keywords | PubMed ID |
---|---|---|---|---|
GO:0000166 | nucleotide binding | IEA | - | |
GO:0005524 | ATP binding | IEA | - | |
GO:0005524 | ATP binding | NAS | - | |
GO:0004396 | hexokinase activity | EXP | 7150652 | |
GO:0004396 | hexokinase activity | IEA | - | |
GO:0004396 | hexokinase activity | NAS | - | |
GO:0004190 | aspartic-type endopeptidase activity | IEA | - | |
GO:0016740 | transferase activity | IEA | - | |
GO:0016301 | kinase activity | IEA | - | |
Biological process | 去的术语 | Evidence | Neuro keywords | PubMed ID |
GO:0006508 | proteolysis | IEA | - | |
GO:0006096 | glycolysis | IEA | - | |
GO:0006096 | glycolysis | NAS | - | |
Cellular component | 去的术语 | Evidence | Neuro keywords | PubMed ID |
GO:0005829 | cytosol | EXP | 7150652 | |
GO:0016020 | membrane | NAS | - |
Section V. Pathway annotation
Pathway name | Pathway size | # SZGR 2.0 genes in pathway | Info |
---|---|---|---|
KEGG GLYCOLYSIS GLUCONEOGENESIS | 62 | 41 | All SZGR 2.0 genes in this pathway |
KEGG FRUCTOSE AND MANNOSE METABOLISM | 34 | 23 | All SZGR 2.0 genes in this pathway |
KEGG GALACTOSE METABOLISM | 26 | 22 | All SZGR 2.0 genes in this pathway |
KEGG STARCH AND SUCROSE METABOLISM | 52 | 33 | All SZGR 2.0 genes in this pathway |
KEGG AMINO SUGAR AND NUCLEOTIDE SUGAR METABOLISM | 44 | 30 | All SZGR 2.0 genes in this pathway |
KEGG INSULIN SIGNALING PATHWAY | 137 | 103 | All SZGR 2.0 genes in this pathway |
KEGG TYPE II DIABETES MELLITUS | 47 | 41 | All SZGR 2.0 genes in this pathway |
REACTOME TRANSMEMBRANE TRANSPORT OF SMALL MOLECULES | 413 | 270 | All SZGR 2.0 genes in this pathway |
REACTOME SLC MEDIATED TRANSMEMBRANE TRANSPORT | 241 | 157 | All SZGR 2.0 genes in this pathway |
REACTOME GLUCOSE TRANSPORT | 38 | 29 | All SZGR 2.0 genes in this pathway |
REACTOME METABOLISM OF CARBOHYDRATES | 247 | 154 | All SZGR 2.0 genes in this pathway |
TAKEDA TARGETS OF NUP98 HOXA9 FUSION 8D DN | 205 | 127 | All SZGR 2.0 genes in this pathway |
ROSS AML WITH MLL FUSIONS | 78 | 45 | All SZGR 2.0 genes in this pathway |
VERHAAK AML WITH NPM1 MUTATED UP | 183 | 111 | All SZGR 2.0 genes in this pathway |
ZHENG BOUND BY FOXP3 | 491 | 310 | All SZGR 2.0 genes in this pathway |
VANTVEER BREAST CANCER ESR1 DN | 240 | 153 | All SZGR 2.0 genes in this pathway |
CHEN METABOLIC SYNDROM NETWORK | 1210 | 725 | All SZGR 2.0 genes in this pathway |
MARTENS TRETINOIN RESPONSE UP | 857 | 456 | All SZGR 2.0 genes in this pathway |
VERHAAK GLIOBLASTOMA MESENCHYMAL | 216 | 130 | All SZGR 2.0 genes in this pathway |
CHYLA CBFA2T3 TARGETS UP | 387 | 225 | All SZGR 2.0 genes in this pathway |
PILON KLF1 TARGETS DN | 1972 | 1213 | All SZGR 2.0 genes in this pathway |
Section VI. microRNA annotation
miRNA family | Target position | miRNA ID | miRNA seq | ||
---|---|---|---|---|---|
UTR start | UTR end | Match method | |||
miR-137 | 177 | 183 | 1A | hsa-miR-137 | UAUUGCUUAAGAAUACGCGUAG |
- SZ: miRNAs which differentially expressed in brain cortex of schizophrenia patients comparing with control samples using microarray. Clickhereto see the list of SZ related miRNAs.
- Brain: miRNAs which are expressed in brain based on miRNA microarray expression studies. Clickhereto see the list of brain related miRNAs.