Gene Page:MNX1

Summary?
GeneID 3110
Symbol MNX1
Synonyms HB9|HLXB9|HOXHB9|SCRA1
Description motor neuron and pancreas homeobox 1
Reference MIM:142994|HGNC:HGNC:4979|Ensembl:ENSG00000130675|HPRD:00874|Vega:OTTHUMG00000157181
Gene type protein-coding
Map location 7q36
Pascal p-value 0.634
Fetal beta 0.176
DMG 2 (# studies)

Gene in Data Sources
Gene set name Method of gene set Description Info
DMG:Jaffe_2016 Genome-wide DNA methylation analysis This dataset includes 2,104 probes/CpGs associated with SZ patients (n=108) compared to 136 controls at Bonferroni-adjusted P < 0.05. 2
DMG:Wockner_2014 Genome-wide DNA methylation analysis This dataset includes 4641 differentially methylated probes corresponding to 2929 unique genes between schizophrenia patients (n=24) and controls (n=24). 2
GO_Annotation Mapping neuro-related keywords to Gene Ontology annotations Hits with neuro-related keywords: 1

Section I. Genetics and epigenetics annotation

@Differentially methylated gene

Probe Chromosome Position Nearest gene P (dis) Beta (dis) FDR (dis) Study
cg07691705 7 156802325 MNX1 2.57E-4 -0.331 0.038 DMG:Wockner_2014
cg21182960 7 156812171 MNX1 5.81E-8 -0.016 1.48E-5 DMG:Jaffe_2016


Section II. Transcriptome annotation

General gene expression (GTEx)

Not available

Gene expression during devlopment (BrainCloud)

Footnote:
A total of 269 time points ploted, with n=38 fetal samples (x=1:38). Each triangle represents one time point.

Gene expression of temporal and spatial changes (BrainSpan)

Footnote:
SC: sub-cortical regions; SM: sensory-motor regions; FC: frontal cortex; and TP: temporal-parietal cortex
死神:胎儿(13 - 26 postconception周),ST2: early infancy to late childhood (4 months to 11 years), and ST3: adolescence to adulthood (13 - 23 years)
The bar shown representes the lower 25% and upper 25% of the expression distribution.

No co-expressed genes in brain regions


Section III. Gene Ontology annotation

Molecular function 去的术语 Evidence Neuro keywords PubMed ID
GO:0003700 transcription factor activity NAS -
GO:0003702 RNA polymerase II transcription factor activity TAS 7914194
GO:0043565 sequence-specific DNA binding IEA -
Biological process 去的术语 Evidence Neuro keywords PubMed ID
GO:0030182 neuron differentiation IEA neuron (GO term level: 8) -
GO:0006357 regulation of transcription from RNA polymerase II promoter TAS 9843207
GO:0009653 anatomical structure morphogenesis TAS 9843207
GO:0006959 humoral immune response TAS 7914194
GO:0021675 nerve development IEA -
Cellular component 去的术语 Evidence Neuro keywords PubMed ID
GO:0005634 nucleus NAS -

Section V. Pathway annotation

Pathway name Pathway size # SZGR 2.0 genes in pathway Info
KEGG MATURITY ONSET DIABETES OF THE YOUNG 25 19 All SZGR 2.0 genes in this pathway
LINDGREN BLADDER CANCER CLUSTER 1 DN 378 231 All SZGR 2.0 genes in this pathway
KIM MYCN AMPLIFICATION TARGETS UP 92 64 All SZGR 2.0 genes in this pathway
BENPORATH SUZ12 TARGETS 1038 678 All SZGR 2.0 genes in this pathway
BENPORATH EED TARGETS 1062 725 All SZGR 2.0 genes in this pathway
BENPORATH ES WITH H3K27ME3 1118 744 All SZGR 2.0 genes in this pathway
BENPORATH PRC2 TARGETS 652 441 All SZGR 2.0 genes in this pathway
BENPORATH MYC TARGETS WITH EBOX 230 156 All SZGR 2.0 genes in this pathway
BENPORATH CYCLING GENES 648 385 All SZGR 2.0 genes in this pathway
SHIN B CELL LYMPHOMA CLUSTER 1 13 11 All SZGR 2.0 genes in this pathway
STOSSI RESPONSE TO ESTRADIOL 50 35 All SZGR 2.0 genes in this pathway
ZHOU PANCREATIC EXOCRINE PROGENITOR 11 10 All SZGR 2.0 genes in this pathway
GRESHOCK CANCER COPY NUMBER UP 323 240 All SZGR 2.0 genes in this pathway
MEISSNER NPC HCP WITH H3K4ME3 AND H3K27ME3 142 103 All SZGR 2.0 genes in this pathway
MEISSNER BRAIN HCP WITH H3K27ME3 269 159 All SZGR 2.0 genes in this pathway
DANG BOUND BY MYC 1103 714 All SZGR 2.0 genes in this pathway
MIKKELSEN NPC HCP WITH H3K4ME3 AND H3K27ME3 210 148 All SZGR 2.0 genes in this pathway
WHITFIELD CELL CYCLE G1 S 147 76 All SZGR 2.0 genes in this pathway
MARTENS TRETINOIN RESPONSE UP 857 456 All SZGR 2.0 genes in this pathway

Section VI. microRNA annotation

miRNA family Target position miRNA ID miRNA seq
UTR start UTR end Match method
miR-410 567 573 1A hsa-miR-410 AAUAUAACACAGAUGGCCUGU
miR-496 639 645 1A hsa-miR-496 AUUACAUGGCCAAUCUC